ID: 1050177574

View in Genome Browser
Species Human (GRCh38)
Location 9:2884139-2884161
Sequence TTTATGGGCATGACCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050177574_1050177583 28 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177583 9:2884190-2884212 AAGGCAATGCCAGCCTCTGTTGG No data
1050177574_1050177579 3 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG No data
1050177574_1050177578 2 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177578 9:2884164-2884186 TGTCCTGCTGCATCACAGGATGG No data
1050177574_1050177584 29 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177584 9:2884191-2884213 AGGCAATGCCAGCCTCTGTTGGG No data
1050177574_1050177577 -2 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177577 9:2884160-2884182 AATGTGTCCTGCTGCATCACAGG No data
1050177574_1050177580 4 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177580 9:2884166-2884188 TCCTGCTGCATCACAGGATGGGG No data
1050177574_1050177582 9 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177582 9:2884171-2884193 CTGCATCACAGGATGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050177574 Original CRISPR TTTATGGGCATGACCCTTCC TGG (reversed) Intergenic
No off target data available for this crispr