ID: 1050177579

View in Genome Browser
Species Human (GRCh38)
Location 9:2884165-2884187
Sequence GTCCTGCTGCATCACAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050177574_1050177579 3 Left 1050177574 9:2884139-2884161 CCAGGAAGGGTCATGCCCATAAA No data
Right 1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG No data
1050177569_1050177579 20 Left 1050177569 9:2884122-2884144 CCCTTCCTGGGCACAGGCCAGGA No data
Right 1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG No data
1050177570_1050177579 19 Left 1050177570 9:2884123-2884145 CCTTCCTGGGCACAGGCCAGGAA No data
Right 1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG No data
1050177573_1050177579 15 Left 1050177573 9:2884127-2884149 CCTGGGCACAGGCCAGGAAGGGT No data
Right 1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050177579 Original CRISPR GTCCTGCTGCATCACAGGAT GGG Intergenic
No off target data available for this crispr