ID: 1050182445

View in Genome Browser
Species Human (GRCh38)
Location 9:2935091-2935113
Sequence GCTGCCGGACAGGCAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050182445_1050182449 -5 Left 1050182445 9:2935091-2935113 CCTGGAGCTGCCTGTCCGGCAGC No data
Right 1050182449 9:2935109-2935131 GCAGCAGCAGTTGGCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050182445 Original CRISPR GCTGCCGGACAGGCAGCTCC AGG (reversed) Intergenic
No off target data available for this crispr