ID: 1050186461

View in Genome Browser
Species Human (GRCh38)
Location 9:2980239-2980261
Sequence GCAGTAAGTCAGTTTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050186459_1050186461 -10 Left 1050186459 9:2980226-2980248 CCAAGAAACCTCAGCAGTAAGTC No data
Right 1050186461 9:2980239-2980261 GCAGTAAGTCAGTTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050186461 Original CRISPR GCAGTAAGTCAGTTTCAAGC AGG Intergenic
No off target data available for this crispr