ID: 1050191972

View in Genome Browser
Species Human (GRCh38)
Location 9:3035793-3035815
Sequence TGCCACAGCACTAGGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050191972_1050191979 29 Left 1050191972 9:3035793-3035815 CCTGGCACCCTAGTGCTGTGGCA No data
Right 1050191979 9:3035845-3035867 TTGGCCAAATCAGTCAGGACAGG No data
1050191972_1050191978 24 Left 1050191972 9:3035793-3035815 CCTGGCACCCTAGTGCTGTGGCA No data
Right 1050191978 9:3035840-3035862 TCATGTTGGCCAAATCAGTCAGG No data
1050191972_1050191977 10 Left 1050191972 9:3035793-3035815 CCTGGCACCCTAGTGCTGTGGCA No data
Right 1050191977 9:3035826-3035848 GGCAACTGAACTGTTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050191972 Original CRISPR TGCCACAGCACTAGGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr