ID: 1050193362

View in Genome Browser
Species Human (GRCh38)
Location 9:3053690-3053712
Sequence ATGTAAGAATTGTGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050193362_1050193368 16 Left 1050193362 9:3053690-3053712 CCCATTGCCCACAATTCTTACAT No data
Right 1050193368 9:3053729-3053751 GTGTCTCTTGACAGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050193362 Original CRISPR ATGTAAGAATTGTGGGCAAT GGG (reversed) Intergenic
No off target data available for this crispr