ID: 1050199912

View in Genome Browser
Species Human (GRCh38)
Location 9:3133200-3133222
Sequence GAGGAGAAGTCTCAGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050199910_1050199912 -4 Left 1050199910 9:3133181-3133203 CCTGTATCTTTGGCAATTGGAGG No data
Right 1050199912 9:3133200-3133222 GAGGAGAAGTCTCAGCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050199912 Original CRISPR GAGGAGAAGTCTCAGCTGAT TGG Intergenic
No off target data available for this crispr