ID: 1050200363

View in Genome Browser
Species Human (GRCh38)
Location 9:3138963-3138985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050200355_1050200363 25 Left 1050200355 9:3138915-3138937 CCAAGAGAAAGAAAGTTACAACA No data
Right 1050200363 9:3138963-3138985 ACTACTTTCAACACTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050200363 Original CRISPR ACTACTTTCAACACTGGTGC TGG Intergenic
No off target data available for this crispr