ID: 1050204272

View in Genome Browser
Species Human (GRCh38)
Location 9:3181060-3181082
Sequence GCGGGTACACGCACGCCGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050204265_1050204272 17 Left 1050204265 9:3181020-3181042 CCGCACTTCTACACGCGCGCGCC No data
Right 1050204272 9:3181060-3181082 GCGGGTACACGCACGCCGACCGG No data
1050204268_1050204272 -4 Left 1050204268 9:3181041-3181063 CCGGGCAACATAGCGCACCGCGG No data
Right 1050204272 9:3181060-3181082 GCGGGTACACGCACGCCGACCGG No data
1050204264_1050204272 18 Left 1050204264 9:3181019-3181041 CCCGCACTTCTACACGCGCGCGC No data
Right 1050204272 9:3181060-3181082 GCGGGTACACGCACGCCGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050204272 Original CRISPR GCGGGTACACGCACGCCGAC CGG Intergenic