ID: 1050204489

View in Genome Browser
Species Human (GRCh38)
Location 9:3182354-3182376
Sequence TTGAAGAAAAGGTCCGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050204489_1050204494 24 Left 1050204489 9:3182354-3182376 CCATAAACGGACCTTTTCTTCAA No data
Right 1050204494 9:3182401-3182423 CCCAGTCTGTGACCTCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050204489 Original CRISPR TTGAAGAAAAGGTCCGTTTA TGG (reversed) Intergenic
No off target data available for this crispr