ID: 1050206091

View in Genome Browser
Species Human (GRCh38)
Location 9:3197798-3197820
Sequence TTTCTCTTTCTCAATTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050206091_1050206096 26 Left 1050206091 9:3197798-3197820 CCATTGAAATTGAGAAAGAGAAA No data
Right 1050206096 9:3197847-3197869 AGGCATCTCCACAAAACATGAGG No data
1050206091_1050206093 3 Left 1050206091 9:3197798-3197820 CCATTGAAATTGAGAAAGAGAAA No data
Right 1050206093 9:3197824-3197846 GAGTTTCAGACCACATTTGAAGG No data
1050206091_1050206094 6 Left 1050206091 9:3197798-3197820 CCATTGAAATTGAGAAAGAGAAA No data
Right 1050206094 9:3197827-3197849 TTTCAGACCACATTTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050206091 Original CRISPR TTTCTCTTTCTCAATTTCAA TGG (reversed) Intergenic