ID: 1050206095

View in Genome Browser
Species Human (GRCh38)
Location 9:3197834-3197856
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050206095_1050206099 18 Left 1050206095 9:3197834-3197856 CCACATTTGAAGGAGGCATCTCC No data
Right 1050206099 9:3197875-3197897 TTTTACATTTTAAAAGGCAAAGG No data
1050206095_1050206098 12 Left 1050206095 9:3197834-3197856 CCACATTTGAAGGAGGCATCTCC No data
Right 1050206098 9:3197869-3197891 GTCGAGTTTTACATTTTAAAAGG No data
1050206095_1050206096 -10 Left 1050206095 9:3197834-3197856 CCACATTTGAAGGAGGCATCTCC No data
Right 1050206096 9:3197847-3197869 AGGCATCTCCACAAAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050206095 Original CRISPR GGAGATGCCTCCTTCAAATG TGG (reversed) Intergenic