ID: 1050206096 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:3197847-3197869 |
Sequence | AGGCATCTCCACAAAACATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050206095_1050206096 | -10 | Left | 1050206095 | 9:3197834-3197856 | CCACATTTGAAGGAGGCATCTCC | No data | ||
Right | 1050206096 | 9:3197847-3197869 | AGGCATCTCCACAAAACATGAGG | No data | ||||
1050206091_1050206096 | 26 | Left | 1050206091 | 9:3197798-3197820 | CCATTGAAATTGAGAAAGAGAAA | No data | ||
Right | 1050206096 | 9:3197847-3197869 | AGGCATCTCCACAAAACATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050206096 | Original CRISPR | AGGCATCTCCACAAAACATG AGG | Intergenic | ||