ID: 1050206096

View in Genome Browser
Species Human (GRCh38)
Location 9:3197847-3197869
Sequence AGGCATCTCCACAAAACATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050206095_1050206096 -10 Left 1050206095 9:3197834-3197856 CCACATTTGAAGGAGGCATCTCC No data
Right 1050206096 9:3197847-3197869 AGGCATCTCCACAAAACATGAGG No data
1050206091_1050206096 26 Left 1050206091 9:3197798-3197820 CCATTGAAATTGAGAAAGAGAAA No data
Right 1050206096 9:3197847-3197869 AGGCATCTCCACAAAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050206096 Original CRISPR AGGCATCTCCACAAAACATG AGG Intergenic
No off target data available for this crispr