ID: 1050206097 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:3197855-3197877 |
Sequence | AAACTCGACCTCATGTTTTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050206097_1050206099 | -3 | Left | 1050206097 | 9:3197855-3197877 | CCACAAAACATGAGGTCGAGTTT | No data | ||
Right | 1050206099 | 9:3197875-3197897 | TTTTACATTTTAAAAGGCAAAGG | No data | ||||
1050206097_1050206098 | -9 | Left | 1050206097 | 9:3197855-3197877 | CCACAAAACATGAGGTCGAGTTT | No data | ||
Right | 1050206098 | 9:3197869-3197891 | GTCGAGTTTTACATTTTAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050206097 | Original CRISPR | AAACTCGACCTCATGTTTTG TGG (reversed) | Intergenic | ||