ID: 1050206099

View in Genome Browser
Species Human (GRCh38)
Location 9:3197875-3197897
Sequence TTTTACATTTTAAAAGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050206095_1050206099 18 Left 1050206095 9:3197834-3197856 CCACATTTGAAGGAGGCATCTCC No data
Right 1050206099 9:3197875-3197897 TTTTACATTTTAAAAGGCAAAGG No data
1050206097_1050206099 -3 Left 1050206097 9:3197855-3197877 CCACAAAACATGAGGTCGAGTTT No data
Right 1050206099 9:3197875-3197897 TTTTACATTTTAAAAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050206099 Original CRISPR TTTTACATTTTAAAAGGCAA AGG Intergenic
No off target data available for this crispr