ID: 1050208640

View in Genome Browser
Species Human (GRCh38)
Location 9:3227678-3227700
Sequence ATCATCAGTGTTGCTTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050208633_1050208640 26 Left 1050208633 9:3227629-3227651 CCTGGGATGAAATCCCTAAATTT 0: 1
1: 0
2: 2
3: 9
4: 160
Right 1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG No data
1050208632_1050208640 27 Left 1050208632 9:3227628-3227650 CCCTGGGATGAAATCCCTAAATT 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG No data
1050208637_1050208640 13 Left 1050208637 9:3227642-3227664 CCCTAAATTTGGGTTATGAGGCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG No data
1050208638_1050208640 12 Left 1050208638 9:3227643-3227665 CCTAAATTTGGGTTATGAGGCTT 0: 1
1: 0
2: 2
3: 12
4: 138
Right 1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050208640 Original CRISPR ATCATCAGTGTTGCTTTATG TGG Intronic
No off target data available for this crispr