ID: 1050211750

View in Genome Browser
Species Human (GRCh38)
Location 9:3267245-3267267
Sequence TTTTATGTTGTGGGTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050211750_1050211757 6 Left 1050211750 9:3267245-3267267 CCTGAAGCACCCACAACATAAAA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1050211757 9:3267274-3267296 TTTGTAGGTTCTCTATAATGGGG No data
1050211750_1050211758 10 Left 1050211750 9:3267245-3267267 CCTGAAGCACCCACAACATAAAA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG No data
1050211750_1050211755 4 Left 1050211750 9:3267245-3267267 CCTGAAGCACCCACAACATAAAA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1050211755 9:3267272-3267294 CCTTTGTAGGTTCTCTATAATGG No data
1050211750_1050211753 -9 Left 1050211750 9:3267245-3267267 CCTGAAGCACCCACAACATAAAA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1050211753 9:3267259-3267281 AACATAAAAGTAACCTTTGTAGG No data
1050211750_1050211756 5 Left 1050211750 9:3267245-3267267 CCTGAAGCACCCACAACATAAAA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1050211756 9:3267273-3267295 CTTTGTAGGTTCTCTATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050211750 Original CRISPR TTTTATGTTGTGGGTGCTTC AGG (reversed) Intronic
900710749 1:4112018-4112040 CTTCAGGTTGTGGGTGATTCTGG + Intergenic
900765065 1:4499453-4499475 ACATATTTTGTGGGTGCTTCTGG - Intergenic
902736454 1:18404514-18404536 TTTATTGTTGTGGGTTGTTCTGG - Intergenic
906019903 1:42618692-42618714 TATTATGTAGTGGGTGCTGATGG + Intronic
907895619 1:58687434-58687456 TTTTATGTTGGTGGTACTTATGG - Intronic
908906369 1:69016327-69016349 TTTTATTTTGTTTCTGCTTCTGG - Intergenic
910802711 1:91161606-91161628 TTTTAGGTGGTGGCTGGTTCTGG + Intergenic
910870592 1:91829544-91829566 TGCTATGTTCTGGGTGCTTCTGG - Intronic
910988321 1:93028001-93028023 TCTTCTGTGGTGGCTGCTTCTGG + Intergenic
911619952 1:100055353-100055375 TTTTTTTTTGTAGTTGCTTCTGG + Intronic
912395864 1:109343459-109343481 CTTTCAGTTGTGGGTGCTTCAGG + Intronic
913019460 1:114773487-114773509 TTTTATTTTGTGTGTGTTTTTGG + Exonic
913133266 1:115862702-115862724 TTAAATGTTGCGGGTCCTTCAGG - Intergenic
914942255 1:152033599-152033621 TTTCATGTTGTGGGTAGTTTGGG + Intronic
915126026 1:153665528-153665550 TTTTATGTTGTGGGAGTTTTTGG - Intronic
917073660 1:171180397-171180419 TTTTATTTTGTTTGTGCTTTTGG - Intergenic
917390232 1:174528696-174528718 TTTTATGTTGTATCTGCTTGGGG + Intronic
920696874 1:208187568-208187590 TTTTATCTTGTGAGAGTTTCAGG - Intronic
920768832 1:208860106-208860128 TTTTATGATCTGAGAGCTTCAGG - Intergenic
921787525 1:219248689-219248711 TTCTATTTTGTGGTTGCTTCAGG + Intergenic
922456763 1:225779848-225779870 GTTTATACTGTGGGTACTTCTGG - Intronic
923336171 1:232972242-232972264 TTTTTTGTTGTTGTTGCTTTGGG + Intronic
924131143 1:240909798-240909820 TTTCCTGTTCTGGGTGCTACTGG + Intronic
1063512450 10:6659183-6659205 TTTTATGTTGTGGGTTCTTTGGG + Intergenic
1063529873 10:6820755-6820777 TTTTGTGTTGTGAATGCGTCTGG + Intergenic
1064880121 10:20042086-20042108 TTTCATGTTGTGTGTACCTCGGG + Intronic
1065446519 10:25807707-25807729 TTTTATTTTGTGGGTTTTTTTGG + Intergenic
1065680417 10:28225287-28225309 TCTTATGTTGTTGATGCTTTTGG - Intronic
1066384081 10:34927339-34927361 TTTTTTGTTGTCTGTGCTTTTGG - Intergenic
1067469506 10:46526138-46526160 TTTTATGATGTGTGTGGTTTTGG - Intergenic
1068132929 10:52917217-52917239 TTTTTTGTTGTTGTTGTTTCAGG + Intergenic
1069017930 10:63452054-63452076 TATTTTGTTGTTGGTGCTTTTGG - Intronic
1070230778 10:74564809-74564831 TTTTATTTTGTGTGAGATTCTGG - Intronic
1070552549 10:77502077-77502099 TTTTATGTTGTGTGACCTTGGGG - Intronic
1070652526 10:78248098-78248120 TTTTATTTTCAGGGTGCTTTTGG - Intergenic
1072014588 10:91334457-91334479 TTTTAGGTTGGGGGTTCTTTGGG - Intergenic
1072748143 10:97956595-97956617 TTATATTTTGTGGGTGCTAGTGG - Intronic
1073223847 10:101899553-101899575 TTTTTTGTTGTTGGTGATTTGGG - Intronic
1074544895 10:114394706-114394728 GTGTGAGTTGTGGGTGCTTCAGG - Intronic
1074693517 10:116028054-116028076 TTTTATTTTGGGGGTGCACCAGG + Intergenic
1074741581 10:116489627-116489649 TTTTTTGTTTTGGGTGCCTTGGG - Intergenic
1075531908 10:123236820-123236842 TTTTTTCTTGTGGGGGTTTCAGG + Intergenic
1075663247 10:124212914-124212936 GTGTCTGTTGTGGGTGTTTCAGG - Intergenic
1077712731 11:4552618-4552640 TTTTCTGCTGGGGGTGCCTCTGG - Intergenic
1078811631 11:14773728-14773750 TTTTTTGTTGTTGTTCCTTCTGG + Intronic
1080866671 11:36201439-36201461 TTTTTTGTTGTGGGTTTTTGTGG + Intronic
1081072391 11:38627887-38627909 TTTTTTGTTTTGGGTGTTTCTGG + Intergenic
1081134767 11:39426650-39426672 TTTTCTGTTGTTGGTGGTTTTGG - Intergenic
1082626004 11:55486273-55486295 TACAATGTTGTGGGTGATTCTGG + Intergenic
1083018073 11:59476951-59476973 TTTAATGTTGTGGCTGCTCCTGG - Intergenic
1085526505 11:77167168-77167190 TTTTGAGTTGTGTGTGCTGCAGG + Intronic
1086449877 11:86905472-86905494 TTTTATTTTGTGTCTGCTTGTGG - Intronic
1089406859 11:118204650-118204672 TTTTGTTATGTGGGTGCTTGGGG - Intronic
1094390921 12:29949590-29949612 TTTTCTTTTGTTGGTGCTGCAGG + Intergenic
1096198337 12:49663478-49663500 TGTCAGATTGTGGGTGCTTCAGG - Intronic
1096223646 12:49849385-49849407 TTTTTTGTTGTCTGTTCTTCTGG - Intergenic
1097022825 12:56032885-56032907 TTGTCTGTGGTGGGTGCTTTAGG + Intronic
1100501803 12:95181506-95181528 TTTTATGTAGTGCTTGTTTCAGG - Intronic
1104235008 12:126925759-126925781 TTTTGTGCTTTGGGTGCTCCTGG - Intergenic
1104601670 12:130158411-130158433 CTTTAGGATGGGGGTGCTTCGGG + Intergenic
1105021907 12:132822444-132822466 TAGGATGTTGTGGGTGCTCCAGG - Intronic
1105366607 13:19771123-19771145 TTTTATGTTGTTGTTGTTTTTGG + Intronic
1107395742 13:40015092-40015114 TTTTATGATGTTGGTGGTCCCGG - Intergenic
1107910671 13:45102491-45102513 TTTAATGTTTTGAGTGTTTCTGG - Intergenic
1108018116 13:46097106-46097128 TATTCTGTTGTGGGTGCTCCTGG - Intronic
1109314210 13:60731060-60731082 ATATATTTTGTGGGTGATTCTGG - Intergenic
1113035612 13:106045095-106045117 TTTTATATTGTGGGTGCGTGTGG - Intergenic
1113274712 13:108715759-108715781 TATTTTGTTGTGGCTGCTTCTGG + Intronic
1114948981 14:27723294-27723316 TTTTATATTGTGAATACTTCAGG - Intergenic
1115139216 14:30149345-30149367 TTTTTTGTTGTGTCTGCGTCTGG - Intronic
1116064329 14:39963402-39963424 TTTTTTGTTGTATTTGCTTCTGG - Intergenic
1116419333 14:44714532-44714554 TTATATCTTCTGGATGCTTCAGG + Intergenic
1117613829 14:57512310-57512332 TATTTTGTTGTGGGTGGTACTGG + Intergenic
1119111147 14:71975441-71975463 TTTTATTTGGTTGGTGCTTGGGG + Intronic
1120545506 14:85806763-85806785 TTTTTTGTTGTGGGTGTTTAGGG + Intergenic
1121866824 14:97369911-97369933 TTTTCTGTTGTGATTTCTTCTGG + Intergenic
1122845345 14:104493114-104493136 TTTTATTTTGTGGATTCTTTGGG - Intronic
1123823438 15:24055861-24055883 TTTTATGTTGCTGTTGCTTTGGG - Intergenic
1123863056 15:24487525-24487547 GTTTATGTTGTAGTTGCTTTCGG + Intergenic
1124157358 15:27237715-27237737 CTTTATGTTGTGGGTGCAGCTGG - Intronic
1124841124 15:33243133-33243155 TTTTATTTTCTGTGTGATTCAGG - Intergenic
1125882211 15:43204621-43204643 ATGTGTGTGGTGGGTGCTTCTGG - Intronic
1128913825 15:71541632-71541654 TTTTTTGTTGTTGTTGCTTCAGG + Intronic
1131579926 15:93633132-93633154 ATTTCTGTTGTTGGTGCTTGTGG + Intergenic
1133267331 16:4593068-4593090 TTCTATGCTGTGGACGCTTCTGG + Intronic
1133534651 16:6689727-6689749 TTCCATGTTGTGGGAGTTTCAGG - Intronic
1135981135 16:27148303-27148325 TTTAGTGTTGTGGGTGTTTCAGG - Intergenic
1140378715 16:74467019-74467041 TTTTGTTTTGTGTGTGTTTCCGG - Intronic
1144550414 17:16236276-16236298 TTTTATGTATTCGGTGTTTCAGG + Intronic
1145991466 17:29081600-29081622 TTCTATGTTGTGGGGGCAGCAGG + Intronic
1148529507 17:48376140-48376162 TTTTATTTTTTGCTTGCTTCAGG + Intronic
1153033229 18:734580-734602 TTGTATGTTGTAGTTGCTCCTGG - Intronic
1156300698 18:35833575-35833597 TTTCATGTTGTAGTTCCTTCAGG - Intergenic
1156977673 18:43243779-43243801 TTTTATGACTTGGGTACTTCTGG + Intergenic
1159192136 18:65060266-65060288 TTTTAGGTTGTAGAAGCTTCTGG + Intergenic
1159419254 18:68195293-68195315 TTTTATGTCGTTGTTACTTCAGG - Intergenic
1159649187 18:70956951-70956973 TTTTTTGTTGTTGCTGCTTCAGG + Intergenic
1159690784 18:71484566-71484588 TTTTTTGTTGTTGTTGTTTCGGG + Intergenic
1160935044 19:1590788-1590810 TTTTCTGTTGGGGGTGCCTGGGG - Intronic
1161271362 19:3391253-3391275 TTTTTTGGTGGGGGTGGTTCTGG - Intronic
925594092 2:5538382-5538404 TTTTTTGTTGTTGTTGCTTTTGG + Intergenic
926804357 2:16691471-16691493 TTTTAGGCTGTGGCTGCCTCAGG - Intergenic
929720762 2:44364712-44364734 ATTTATTTTGTTGGTGCATCTGG + Intronic
932580478 2:72989982-72990004 CTTAATGTTGTGGGTGGTTGGGG + Intronic
932893732 2:75618472-75618494 ATTTATGTTTTGGGGGCTACAGG + Intergenic
933043491 2:77501255-77501277 TTTTATTTTGCTGGTGCTTTTGG - Intronic
933860977 2:86467494-86467516 TTTTAAATTGTGGGTGCAGCAGG - Intronic
935412241 2:102776810-102776832 TTTGGTGTTGTCGGTGCTTTTGG + Intronic
935562402 2:104572594-104572616 TTTAATGTTCAGCGTGCTTCTGG - Intergenic
935593248 2:104859980-104860002 TTTTATGTGGTGGATACTACTGG + Exonic
935646947 2:105345320-105345342 TTTTTGCTTGTGGGGGCTTCAGG - Exonic
936590938 2:113803681-113803703 ATTTAAGTTCTGGGTGTTTCAGG - Intergenic
937433200 2:121858080-121858102 TTTTATCTTATGGGTATTTCTGG + Intergenic
939948470 2:148439434-148439456 ATTTAAGTTTTGGGTGGTTCTGG + Intronic
940545928 2:155085249-155085271 GTTTTTGTTGTAGTTGCTTCAGG + Intergenic
941015643 2:160352857-160352879 TGCTAAGTTTTGGGTGCTTCTGG + Intronic
942097226 2:172545088-172545110 ATTTCTCTTTTGGGTGCTTCAGG - Intergenic
947143725 2:227043958-227043980 TTAGATGTTATGGGTGATTCTGG - Intronic
948287114 2:236794628-236794650 GTTTGTCTTGTGGGTGCTTGTGG - Intergenic
1169274435 20:4224154-4224176 TTTTATTTTGTGGATGCTTAGGG + Intronic
1175106150 20:56616477-56616499 TTTTATGTACATGGTGCTTCTGG + Intergenic
1177093394 21:16799368-16799390 TTTTATGTGGCAGATGCTTCTGG + Intergenic
1177621898 21:23606391-23606413 TTTTATGTTGTGCCTGTGTCTGG - Intergenic
1179944985 21:44667044-44667066 TTTTCTGTTGTAGGTGTCTCTGG + Intronic
1180098908 21:45575156-45575178 TTTCAGGTTGTTGGTGGTTCAGG + Intergenic
1184134410 22:42538392-42538414 TTTTTTGTTGTGGGTGGTGGTGG - Intergenic
950564582 3:13760428-13760450 TTTTGTGTTGTGGGGGTTTTGGG - Intergenic
952909936 3:38175067-38175089 TCTTATGTTTTGTGTGGTTCAGG + Intronic
953087650 3:39686930-39686952 TTTTATGTTGTGTCTTTTTCTGG - Intergenic
953298422 3:41746830-41746852 ATTTGTGTTGGGGTTGCTTCTGG - Intronic
953639898 3:44697031-44697053 TTGTTTGTTGTGTTTGCTTCTGG - Intergenic
953663374 3:44907235-44907257 TTTCATGTTCTGGGTGACTCAGG - Intronic
955098949 3:55828300-55828322 TTTTATTTTGTGGTTGCTCCTGG - Intronic
956118040 3:65937670-65937692 TTTTATTTTGTGGGTTTTTTGGG + Intronic
958135924 3:89490751-89490773 TTTTATTTTGTAGATGCTTTGGG + Intergenic
958188615 3:90155649-90155671 TTTTACGTTGGCGGTGCTTGAGG - Intergenic
959325461 3:104931219-104931241 TTTTTTGATGTAGGTGCTTAGGG + Intergenic
960474126 3:118103241-118103263 GTTTATGTTGTCTGTGCTTTTGG + Intergenic
961679880 3:128592407-128592429 TTTTTTATTGTGTGTGCTCCAGG - Intergenic
963014928 3:140814053-140814075 TTTTTTGTTGTTGGTTCTTTAGG - Intergenic
963040870 3:141068930-141068952 TTTAAGCTTGTGGGTCCTTCAGG + Intronic
963396597 3:144742322-144742344 TTTAATTATGTGGGTGATTCTGG + Intergenic
965197977 3:165624050-165624072 TTCTCTGTTGGAGGTGCTTCTGG + Intergenic
966064217 3:175797184-175797206 CTTTATGTTGTGTGTGGGTCAGG + Intronic
969035152 4:4247519-4247541 TTGTAAGTGGTGGTTGCTTCTGG - Intronic
969924543 4:10574035-10574057 TTTTTTGTTGTGTGTTCTTTAGG + Intronic
970316125 4:14829883-14829905 TTGTAGGGTCTGGGTGCTTCTGG + Intergenic
972601263 4:40575053-40575075 TTTTTGGTGGTGGGTGCTACTGG + Intronic
973942713 4:55926532-55926554 TTTTTTGCTGTGGGTTCTTTGGG + Intergenic
974893613 4:67911493-67911515 TTTTATTTTTAGGGTGATTCTGG - Exonic
975796731 4:78014001-78014023 TTTAAAATTGTGGCTGCTTCAGG + Intergenic
975803646 4:78089637-78089659 TTTTATATTATGTGTTCTTCAGG - Intronic
975847693 4:78542068-78542090 TTTTATTCTGTTAGTGCTTCGGG + Intronic
980475660 4:133311273-133311295 TTTTTTGTTGTTGTTGTTTCAGG + Intergenic
981454220 4:144934529-144934551 TTTTCTGATGTAGGTGCTTATGG + Intergenic
982804828 4:159750294-159750316 TTTTTTTTTGTGGGGTCTTCTGG + Intergenic
982966557 4:161915620-161915642 TTTGATGTTGTGGGTACTAAGGG + Intronic
983353773 4:166629630-166629652 TTTTAATTTGTGTGTGCTTTTGG - Intergenic
983729383 4:170974758-170974780 TTTTTTGTTGTGTTTGCTTTTGG + Intergenic
984105229 4:175537461-175537483 TTATTTTTTTTGGGTGCTTCAGG - Intergenic
984650418 4:182264219-182264241 TTCTGTGTTGAGGGTACTTCAGG + Intronic
986489683 5:8276375-8276397 TTATATGCTGTGGGTGATCCTGG - Intergenic
987431435 5:17838889-17838911 TTTTTTGTTGTGGCTGTTACTGG - Intergenic
988249172 5:28732559-28732581 TTTTAGGTTCTGGGTGTTTTGGG + Intergenic
988855226 5:35221976-35221998 TTATATGTGTTGGGAGCTTCTGG - Intronic
989612706 5:43310879-43310901 TTTTTAGTTGTGGGTGCATATGG - Intronic
991653968 5:68884303-68884325 GTTTCTGTTGTGGTTGCTGCGGG + Intergenic
992047685 5:72911792-72911814 TTTTATGTTGTAGGAACCTCAGG + Exonic
992569151 5:78036226-78036248 TTTTATTATATGGATGCTTCAGG + Intronic
992786509 5:80175369-80175391 TTTTAAGTTGTGGGTCATTATGG - Intronic
994012846 5:94926967-94926989 CTAAATGTTGTGGGTTCTTCTGG - Intronic
994177254 5:96724515-96724537 TTTTATTTTGTAGATGCTTCTGG - Intronic
994267575 5:97736737-97736759 TTTTTTGTTGTTGTTGCTTTAGG - Intergenic
994512638 5:100724635-100724657 TTTTATGTTATGGTGGCTCCAGG - Intergenic
995429388 5:112057180-112057202 GCTTTTGTTGTGGTTGCTTCTGG - Intergenic
996106792 5:119514209-119514231 TTTTATGTTTTGGGTGTGGCGGG + Intronic
998204651 5:140149870-140149892 TTATCTGTTGTGGCTGCTGCTGG - Intergenic
1000886032 5:166748580-166748602 TTTTATGATGTGTGTGTTTGGGG - Intergenic
1007813016 6:44499639-44499661 TATTATGTGCTGGGTGCTGCTGG + Intergenic
1009695920 6:67102494-67102516 TTTTATTTTTTGGGTGAGTCGGG - Intergenic
1010060602 6:71618125-71618147 TTTTATGTTGGGTGTGCCCCAGG + Intergenic
1011497545 6:87951407-87951429 TCTTAGGTGGTGGGTGCTTGAGG - Intergenic
1012042284 6:94223546-94223568 GTTTTTGTTGTGATTGCTTCTGG + Intergenic
1016247444 6:142000165-142000187 ATTTTTGTTGTGTGTGCTTTTGG - Intergenic
1016811510 6:148265650-148265672 TTTTATGTTCTGAGTGAATCAGG - Intergenic
1017102015 6:150857091-150857113 TTTTACTTTGTGGGTACTCCTGG - Intergenic
1017610445 6:156180367-156180389 TTTTATTTTGTTGGTGGTTTTGG + Intergenic
1022285451 7:28952864-28952886 TGTAATGTTGTGGGACCTTCAGG - Intergenic
1027598130 7:80202072-80202094 TTTTTTGTTGTTGTTGTTTCTGG + Intronic
1027718732 7:81710548-81710570 TTTTATGTTGAGGGTGGTGAGGG - Intronic
1028222159 7:88210418-88210440 CTGTACTTTGTGGGTGCTTCAGG + Intronic
1029983206 7:104898329-104898351 TTTTATGTAATGGGTGGTACTGG - Intronic
1030519336 7:110578329-110578351 CTTTCTGTTGTGGGGGATTCTGG - Intergenic
1033103961 7:138501899-138501921 TTTTTTGTTGTTGTTGCTACTGG - Intronic
1034584020 7:152072835-152072857 TTTTACTTTGTGTGTGCTTGTGG + Intronic
1036107185 8:5853766-5853788 TTTTATGTTGTGAGGGCCTTTGG + Intergenic
1036573123 8:9999283-9999305 ATGTCTGTTGAGGGTGCTTCTGG + Intergenic
1038323902 8:26556435-26556457 TTTAATGTTGTTGATTCTTCGGG - Intronic
1040927013 8:52695319-52695341 TGTTGTGCTGTGGGTACTTCTGG - Intronic
1043267538 8:78285601-78285623 TTTTTTGTTGTTGTTGCTTGCGG + Intergenic
1043409574 8:79979341-79979363 TTTTTCATTGTGGCTGCTTCAGG - Intronic
1044580061 8:93816864-93816886 TTTCATGTTTTGTGTGCTTATGG + Exonic
1046082635 8:109390269-109390291 TTTTATATAGTGGCTGCTTTAGG + Intronic
1046848498 8:118946138-118946160 ATTTATGGTGTGGCTGATTCAGG + Intronic
1047083006 8:121485036-121485058 TGTTCTGTTGTGGATGCTTAAGG - Intergenic
1048192630 8:132303936-132303958 TTTTATGGTGTGTGTGTTTATGG - Intronic
1050211750 9:3267245-3267267 TTTTATGTTGTGGGTGCTTCAGG - Intronic
1050730164 9:8700614-8700636 TTTTCTCTTTTGTGTGCTTCTGG - Intronic
1051768673 9:20551756-20551778 TTTTATGTTTTGGGGCCTCCAGG - Intronic
1055708633 9:79035299-79035321 TGGGATGTTGGGGGTGCTTCTGG + Intergenic
1056480776 9:87003398-87003420 TTTTCTGTTTTGTTTGCTTCAGG + Intergenic
1056495981 9:87155695-87155717 GTTTATGTTTTGGGTGTTTTAGG + Intronic
1057951465 9:99372218-99372240 TTTTGTAGTGTGGGGGCTTCTGG + Intergenic
1059935592 9:119307148-119307170 GTGTTTGTTGGGGGTGCTTCTGG - Intronic
1060491049 9:124084633-124084655 TTTTATTTTGGTGGTGCATCAGG - Intergenic
1186692314 X:11991267-11991289 TTTTAGGTTGTGTCTGCTACAGG + Intergenic
1187671349 X:21669023-21669045 TCTTATGTTGCTGGTGCTTTGGG + Intergenic
1187986708 X:24821227-24821249 TTTTTTGTTGGGGTTGCATCTGG + Intronic
1187995586 X:24922879-24922901 TTTTATGTTATTGTTTCTTCTGG + Intronic
1188880247 X:35483761-35483783 TTTTATGTTGTGTGTGCTTTTGG - Intergenic
1193590108 X:83378862-83378884 TTTTTTGATGTGGGTGTTTAGGG + Intergenic
1194234155 X:91361502-91361524 TTTTTTGTTGTTGGTTTTTCAGG - Intergenic
1195778748 X:108437977-108437999 TTTCAGGTTGTGGCTGCTCCTGG - Exonic
1196600350 X:117594835-117594857 TTTTTTGTTGTGTGTGTGTCAGG + Intergenic
1196998075 X:121406241-121406263 TTTTATATTGTGGGTCTTTTAGG + Intergenic
1197429814 X:126347657-126347679 GTTTTTGTTGTGGATTCTTCAGG - Intergenic
1199194382 X:145009817-145009839 TTTTAGCTTGTTGGTTCTTCTGG - Intergenic
1199810104 X:151340599-151340621 TTTTCCGTTGGTGGTGCTTCTGG + Intergenic
1201229932 Y:11854325-11854347 TTTTGTGTTGTGGGGGGTTGGGG - Intergenic
1201511210 Y:14765662-14765684 TTTTATGTTGTGCGAGTTTCAGG + Intronic