ID: 1050211751

View in Genome Browser
Species Human (GRCh38)
Location 9:3267254-3267276
Sequence AAAGGTTACTTTTATGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050211751_1050211757 -3 Left 1050211751 9:3267254-3267276 CCCACAACATAAAAGTAACCTTT 0: 1
1: 1
2: 3
3: 25
4: 369
Right 1050211757 9:3267274-3267296 TTTGTAGGTTCTCTATAATGGGG No data
1050211751_1050211755 -5 Left 1050211751 9:3267254-3267276 CCCACAACATAAAAGTAACCTTT 0: 1
1: 1
2: 3
3: 25
4: 369
Right 1050211755 9:3267272-3267294 CCTTTGTAGGTTCTCTATAATGG No data
1050211751_1050211758 1 Left 1050211751 9:3267254-3267276 CCCACAACATAAAAGTAACCTTT 0: 1
1: 1
2: 3
3: 25
4: 369
Right 1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG No data
1050211751_1050211756 -4 Left 1050211751 9:3267254-3267276 CCCACAACATAAAAGTAACCTTT 0: 1
1: 1
2: 3
3: 25
4: 369
Right 1050211756 9:3267273-3267295 CTTTGTAGGTTCTCTATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050211751 Original CRISPR AAAGGTTACTTTTATGTTGT GGG (reversed) Intronic
900312182 1:2039035-2039057 AATGGTTAGGTTTATTTTGTGGG - Intergenic
900322374 1:2091364-2091386 AATGGTGAATTTTATGTTATAGG - Intronic
901783107 1:11607612-11607634 AAAGGTCAATTTTATGTTATAGG + Intergenic
903313610 1:22481629-22481651 AAAGGTTGCTTTTAAGTTTCTGG - Intronic
903341500 1:22657722-22657744 ATTGGTTAATTTTATGTTGTAGG + Intronic
904692251 1:32302270-32302292 GATGGTTATTTTTCTGTTGTGGG + Intronic
906451490 1:45952509-45952531 AAGGGTGAATTTTATATTGTTGG + Intronic
906870976 1:49480250-49480272 AAAGAATACTTTCATGTTGTTGG - Intronic
906935106 1:50207974-50207996 ACAGGTAACTTTTGTGTTGGAGG + Intergenic
907064248 1:51464144-51464166 AAAAGTTACTTTTTTGCTCTGGG - Intronic
908869359 1:68590826-68590848 ACAGCCTATTTTTATGTTGTTGG - Intergenic
908962299 1:69712619-69712641 AATGGTTCTTTTTTTGTTGTTGG - Intronic
909127929 1:71698543-71698565 AAATGTTACTTTTCTTTTGGGGG + Intronic
909465453 1:75969003-75969025 AAAGTTTAATTTGATGCTGTGGG - Intergenic
909814325 1:79972825-79972847 AACTGTTGCTTTTATGTAGTAGG - Intergenic
909985516 1:82156381-82156403 AAAGCCTACTTTTCTGTTCTTGG - Intergenic
910181183 1:84485101-84485123 AAAGGTAACTTTTTTATTTTTGG + Intronic
910279821 1:85487082-85487104 AAAAGTTACATTTGTGTTCTTGG + Intronic
910679698 1:89850009-89850031 AAAGGTTACTCTTATTATTTGGG + Intronic
910821301 1:91350995-91351017 AAGGTTTTCTTTTATGTTTTTGG - Intronic
910887183 1:91976862-91976884 AAAGGTTAATTTCCTTTTGTAGG - Intronic
910982374 1:92971805-92971827 AAGGTTTAATTTTAGGTTGTAGG - Intergenic
911003430 1:93191978-93192000 AAAAGTTGTTTTTATGTTTTAGG + Exonic
911540637 1:99153682-99153704 AAATGTTAATTTTATGCTGGTGG + Intergenic
911675902 1:100657952-100657974 AAATGTTACTTTCATTATGTCGG - Intergenic
912007821 1:104926375-104926397 TAAGGTTACTAATGTGTTGTGGG - Intergenic
912066387 1:105749040-105749062 AAAGGTTACTATAGTCTTGTAGG - Intergenic
912092496 1:106097665-106097687 ATAGTTTATTTTTTTGTTGTTGG - Intergenic
912964456 1:114225436-114225458 ACTGGTTACTTTTTTGTTGTGGG + Intergenic
913126391 1:115794235-115794257 AAATATTACTTTTATGTGATTGG + Intergenic
913204803 1:116528509-116528531 CAATGTTTCTTTTATGTTCTTGG + Intronic
913561693 1:120027469-120027491 AAATTTTACTTTTAAGTTTTGGG + Intronic
913591101 1:120326512-120326534 AAATGTTAGTTTCATGTTCTTGG + Intergenic
913636431 1:120766128-120766150 AAATTTTACTTTTAAGTTTTGGG - Intergenic
913652267 1:120928591-120928613 AAATGTTAGTTTCATGTTCTTGG - Intergenic
914168843 1:145200480-145200502 AAATGTTAGTTTCATGTTCTTGG + Intergenic
914523964 1:148444439-148444461 AAATGTTAGTTTCATGTTCTTGG + Intergenic
914599712 1:149191435-149191457 AAATGTTAGTTTCATGTTCTTGG - Intergenic
914642441 1:149622701-149622723 AAATGTTAGTTTCATGTTCTTGG - Intergenic
916335540 1:163666946-163666968 AAAGGTAAATATTATCTTGTGGG - Intergenic
916348639 1:163823619-163823641 AAAGATTACTTTTAGACTGTTGG + Intergenic
916773952 1:167940162-167940184 AAAACTTCCTATTATGTTGTGGG + Intronic
918976491 1:191493370-191493392 AAAGATTACTTTTTTAGTGTAGG - Intergenic
920247738 1:204601048-204601070 AAAGGTCTCCTTTATGTTCTGGG + Intergenic
923602030 1:235411966-235411988 AAAGGTTATGTTCATGTTGCTGG + Intronic
923924239 1:238606001-238606023 AAAGGTAATTTTAATGTTGTTGG + Intergenic
924102147 1:240615813-240615835 AAAGGTTTCTTATATGGTGGAGG - Intergenic
924672110 1:246139192-246139214 AAAGGTTAATTTTAGGTCTTTGG - Intronic
1063208896 10:3860881-3860903 AAAGGTTAAATTTATATTATAGG + Intergenic
1063776049 10:9265859-9265881 AAAAGTTATTTTTAAGTTGCTGG - Intergenic
1067798827 10:49342563-49342585 AAAGAATATTTTTATGATGTTGG - Intergenic
1068233296 10:54199323-54199345 AAAGGTTAGTTTTATATTCAAGG + Intronic
1068626712 10:59256998-59257020 CAAGGTTTCCTTTATGTTTTCGG + Intronic
1070477369 10:76843274-76843296 TAAGTGTACTTTTATTTTGTGGG + Intergenic
1070687109 10:78494116-78494138 AATGTTTATTTTTCTGTTGTTGG - Intergenic
1071902779 10:90139003-90139025 AAATGTTACTTTTACGTTTCTGG + Intergenic
1074628965 10:115228330-115228352 AATGATTCCTTTTATGTTTTTGG + Intronic
1074663245 10:115688427-115688449 ACAGGTAACTCATATGTTGTTGG - Intronic
1078371243 11:10747758-10747780 GATTCTTACTTTTATGTTGTTGG - Intergenic
1079294901 11:19224414-19224436 ACATTTTACTTTTATTTTGTAGG + Exonic
1079376434 11:19896187-19896209 GAGGGTTAATTTTATGTTATAGG - Intronic
1081183928 11:40019089-40019111 AAAGATTAATTCTTTGTTGTGGG - Intergenic
1081985621 11:47300972-47300994 AATGTTTACTTTTTTGTTTTTGG + Intronic
1082689681 11:56284869-56284891 TAAGGATACTTTGTTGTTGTTGG + Intergenic
1083012389 11:59415514-59415536 AAAGGTAGCTTTTGTCTTGTAGG - Intergenic
1086005862 11:82034817-82034839 ATAGGTAATTTTTATGATGTGGG + Intergenic
1086857245 11:91879573-91879595 AATTTTTACTTTTATGATGTGGG + Intergenic
1087974149 11:104523762-104523784 AAAGGTTACATTTAGGTAGCAGG + Intergenic
1088205661 11:107389201-107389223 AATGGTTACTTTTTGGTAGTGGG - Intronic
1088301509 11:108362930-108362952 AAATTATACTTTTATGTTTTAGG - Intronic
1091371100 11:135058862-135058884 AAAGGTTATGTGTATGTGGTGGG + Intergenic
1091442592 12:522971-522993 AGTGGTAACTTTTATGTTATAGG + Intronic
1091449643 12:564529-564551 AAAAGTGATTTTTATGTTATTGG - Exonic
1092494248 12:8976420-8976442 AAAGAATATTTTTCTGTTGTTGG + Intronic
1094211398 12:27896911-27896933 AAACTTGACTTTTATATTGTAGG + Intergenic
1095106429 12:38238736-38238758 AAAGATGACTTTTATTTGGTGGG + Intergenic
1095455262 12:42376952-42376974 TAAGGTTTTTTTTATGTGGTAGG - Intronic
1096497792 12:52048600-52048622 AAAAGTTAGTTTTATTTTCTAGG + Intronic
1096704002 12:53407123-53407145 AAAGGTTAATTTTTTTTTTTAGG + Intronic
1097152964 12:56993318-56993340 AATGGTTAATTTTATGCTATGGG + Intergenic
1097705503 12:62864539-62864561 CCAAGTTACTTTTATGTTGCAGG + Intronic
1098020980 12:66156345-66156367 AAAGATGACTTCTATGTTTTTGG - Intronic
1099602853 12:84763571-84763593 AAAGGCTATTTTTGTTTTGTGGG + Intergenic
1099676408 12:85766551-85766573 AAAGGTTTCATTCATGTGGTGGG + Intergenic
1100682185 12:96937396-96937418 AAATGTTGCTTATATATTGTTGG + Intronic
1105711271 13:23011674-23011696 AAGGGCTACTTTTAGGTTATTGG - Intergenic
1105869166 13:24488682-24488704 AATGGTTAATTTTATCTTTTTGG - Intronic
1106685877 13:32058214-32058236 GAAGTTTACTTATAGGTTGTTGG - Intronic
1107142265 13:37013746-37013768 AAAAGTTACATTTATCTTGAGGG + Intronic
1107229534 13:38091484-38091506 ACATGTTATTTTTATGTGGTAGG - Intergenic
1107318246 13:39157755-39157777 AAAGGTTTCTTATATGCTGGTGG + Intergenic
1107685959 13:42898666-42898688 AAAGATAACTTTTTTGTTATAGG - Intronic
1107897483 13:44980244-44980266 AAAGGTTCTTTTTCTGTTTTTGG - Intronic
1109213728 13:59564058-59564080 AGTGGTTACTTTTATGGTGATGG - Intergenic
1109361063 13:61295120-61295142 AAAGATTAATTTGATATTGTTGG - Intergenic
1109643542 13:65222796-65222818 AAATGTTACCTTTACCTTGTTGG + Intergenic
1110307172 13:74002311-74002333 AAATGTTACTTTTATTTTCTGGG - Intronic
1110877157 13:80524053-80524075 AAAGGTGACTCTTATATTCTGGG - Intergenic
1110902767 13:80844596-80844618 AAAGTTTACTTTTATTTAATAGG - Intergenic
1110921552 13:81093784-81093806 AAATATTACTTTTCTGTTCTAGG + Intergenic
1111029848 13:82581691-82581713 AAAAGTTATTTTTATATTATTGG + Intergenic
1112358648 13:98696442-98696464 AAAGCTTCTTTTTTTGTTGTTGG - Intronic
1116260073 14:42613500-42613522 CAAGGTTAGTGTTATGTTGTAGG + Intergenic
1116735446 14:48685072-48685094 AAAGGTTACTTATTTTATGTTGG - Intergenic
1117068900 14:52038722-52038744 AAGGTTTCCTTTTTTGTTGTTGG - Intronic
1117431373 14:55666450-55666472 AAATGTTACATTTTTGTTTTTGG + Intronic
1121314348 14:92952211-92952233 ATCGGTTACTTTTATGTGGGAGG - Intronic
1122561954 14:102622040-102622062 AAATGTTACTTTTCTGTGGATGG - Intronic
1124410341 15:29431533-29431555 CAAAGTAACTTTTATTTTGTGGG - Intronic
1124506171 15:30276201-30276223 GAAGGTTAATTTTTTGATGTTGG - Intergenic
1124737384 15:32262431-32262453 GAAGGTTAATTTTTTGATGTTGG + Intergenic
1125264296 15:37861963-37861985 AATGGCTACATTTATGTTATAGG - Intergenic
1125368936 15:38949251-38949273 TAAGCTTATTTTTATTTTGTAGG - Intergenic
1126956823 15:53941932-53941954 AAAGGACACTTTTACATTGTTGG + Intergenic
1131606191 15:93905239-93905261 AAAGGTTATATTTATTTTTTTGG - Intergenic
1132176829 15:99722469-99722491 CATGGTGAATTTTATGTTGTTGG - Intronic
1132921213 16:2394912-2394934 AATGGTTACTGTGATCTTGTTGG + Intergenic
1134639626 16:15819846-15819868 GAAGAATACTTTTGTGTTGTGGG - Intronic
1134905298 16:17974645-17974667 AAAAGTTATTTTTAAGTTCTGGG - Intergenic
1135348457 16:21709081-21709103 CATGGTTATTTTTATGTGGTAGG + Intronic
1138871370 16:60891562-60891584 TAAAGTTATTTTTATGTGGTGGG + Intergenic
1139458243 16:67101395-67101417 AGGGCTTACTTTTCTGTTGTAGG - Intergenic
1139695297 16:68669953-68669975 AAAGGTCACTTTTATTTTTTTGG - Intronic
1143251946 17:5529750-5529772 TAAGGTTACTTTTTTTTTTTTGG + Intronic
1146535849 17:33651382-33651404 AATGGTTTCTTTTTTGTTCTCGG - Intronic
1149145383 17:53485242-53485264 ATAGGGTAGTTTTCTGTTGTTGG + Intergenic
1150185203 17:63173368-63173390 AAGGGTTACTGTTATCTTCTTGG - Intronic
1150233306 17:63571485-63571507 AATGGTTATCTTTATGTGGTGGG + Intronic
1150529530 17:65962464-65962486 AAAGATTCCTTTTGTTTTGTTGG - Intronic
1151300988 17:73225639-73225661 AAAGATTACTTCTATGGTGTTGG - Intronic
1151395966 17:73823260-73823282 TATGGTTAGTTTTATTTTGTGGG + Intergenic
1151698151 17:75728541-75728563 GAAGGATAATTTTAAGTTGTGGG - Intronic
1155280171 18:24231242-24231264 AAAGTTTGCTTTAATGTTATGGG + Intronic
1155730723 18:29154509-29154531 AAGATTTACTTTTATGTTTTAGG + Intergenic
1155789980 18:29953429-29953451 AAATGTTACTCTTATCTTTTAGG - Intergenic
1156118142 18:33811993-33812015 AATGGGTATTTTTCTGTTGTTGG - Intergenic
1156858199 18:41807255-41807277 ATATTTTACTTTTATATTGTTGG + Intergenic
1156934655 18:42689168-42689190 AAAGGTAACTTTTTTAGTGTGGG - Intergenic
1157150436 18:45211892-45211914 ACAAGTTCCATTTATGTTGTAGG - Intergenic
1157563712 18:48665487-48665509 AATGGTTAATTTTATGGTATGGG - Intronic
1158809708 18:61018194-61018216 AAAGATTAATTTTGTGTTTTTGG + Intergenic
1159256655 18:65955599-65955621 AAAAGTTTTGTTTATGTTGTTGG - Intergenic
1159506272 18:69340948-69340970 AAAAGTTTATTTTATATTGTTGG + Intergenic
1159820053 18:73129979-73130001 AATGGTTAATTTTATATTATGGG + Intergenic
1159989514 18:74887219-74887241 AAAATTTACTTTTATGATGATGG - Intronic
1160519947 18:79501100-79501122 AAATCTTTTTTTTATGTTGTTGG - Intronic
1162858434 19:13487626-13487648 AATGGTCAATTTTATGTTATGGG + Intronic
1163070441 19:14836177-14836199 AAATGTTTATTTTATGTGGTCGG + Intergenic
1167501814 19:49852342-49852364 AAGGGGTACGTTTAAGTTGTGGG - Intronic
1168079774 19:54001125-54001147 GAAGGTTCCTTTTATTTTCTGGG + Intronic
925220165 2:2132721-2132743 AAATTTTACTTTTAAGTTCTGGG - Intronic
925922349 2:8646107-8646129 TAAGGTTACTGTTAGGTTCTTGG + Intergenic
926555759 2:14356000-14356022 AAATCTTTCTTTTATATTGTAGG - Intergenic
926662531 2:15483135-15483157 AAATGTTGCTTTTATGTTGTTGG - Intronic
929287731 2:40154664-40154686 AAAGTTTTCTTTTTTGTTTTTGG + Intronic
929351418 2:40960462-40960484 AAAGGTAACGTTTATGATGTGGG - Intergenic
930417596 2:51108528-51108550 AAAGGTAACCATTATTTTGTCGG + Intergenic
930968424 2:57361584-57361606 AAGGGTCACTTTTATTCTGTAGG + Intergenic
932528178 2:72496093-72496115 AAGTGTAAATTTTATGTTGTGGG + Intronic
933340197 2:81015165-81015187 AAATATAAATTTTATGTTGTTGG - Intergenic
933534931 2:83559553-83559575 AAACGTTAGTTTTATTCTGTTGG - Intergenic
935403823 2:102687505-102687527 AACGATGACTTTTATGTTGATGG + Intronic
935436402 2:103039355-103039377 AATGATTAATTTTATGTTATCGG - Intergenic
936780711 2:116029420-116029442 AATGGTGAATTTTATGTTGTGGG - Intergenic
937399956 2:121573912-121573934 AAAGCTTACGTTTTTGTTGCTGG - Intronic
939240011 2:139545799-139545821 TAAGGTTAATTTAATATTGTTGG + Intergenic
939869897 2:147515367-147515389 CAAGATTACTTTCATTTTGTTGG - Intergenic
940776922 2:157894385-157894407 AAAGCTTTATTTTATGGTGTGGG - Intronic
940949886 2:159661699-159661721 AATGGTTAATTTTATATTATGGG - Intergenic
941504204 2:166320714-166320736 AAACATTAATTTTGTGTTGTGGG - Intronic
941525991 2:166607994-166608016 AAATATTATTTTTCTGTTGTTGG + Intergenic
941827393 2:169915731-169915753 AAAGGGTAATTTTATGATGAAGG - Intronic
942162819 2:173209960-173209982 AAAGGTTTTTTTTATGATTTTGG + Intronic
943300673 2:186194477-186194499 AAAGGATACTGTTAAGTAGTTGG - Intergenic
945849642 2:214990268-214990290 TAAGGTTGCTTATATGCTGTTGG + Intronic
946481745 2:220063574-220063596 CCAGGTTACTTTTTTGTTATGGG + Intergenic
946594618 2:221293083-221293105 TAAGTTTAATTTTATGTTTTAGG - Intergenic
947117608 2:226789155-226789177 AATGGTTCCTTTTATTTTGATGG - Intronic
947413419 2:229867950-229867972 AGAGGCTACTTTTCTGTAGTTGG - Intronic
947916478 2:233835420-233835442 AAAGGTACCTCTTATATTGTGGG + Intronic
1170135586 20:13070301-13070323 AAAGTATACTTTTCTTTTGTAGG - Intronic
1170361657 20:15553031-15553053 AAAGTGTAATTATATGTTGTTGG + Intronic
1170528869 20:17268974-17268996 AAAGGTGACTCCTAAGTTGTTGG + Intronic
1171946661 20:31384473-31384495 ATAGTTTACTTTTTTGTTTTCGG - Intronic
1172727111 20:37053173-37053195 AAATGTCAGTTTTATCTTGTTGG - Intronic
1173411238 20:42811113-42811135 AAAGATTACTTTATTGTTATTGG + Intronic
1173959948 20:47063067-47063089 AATGGTTAATTCTATGTTATGGG - Intronic
1175122720 20:56728770-56728792 AAAAGTTTCTCTTATCTTGTAGG - Intergenic
1175593256 20:60210769-60210791 AATGGTTACTATTATGTTGGAGG - Intergenic
1175635931 20:60583472-60583494 GAAGCTTATTTTTATGTTGATGG - Intergenic
1178145687 21:29737092-29737114 ATAGGTGACTTTCATATTGTGGG - Intronic
1179535852 21:42051495-42051517 AAAAGCGACTTTGATGTTGTTGG - Intergenic
1182989888 22:34757360-34757382 AAATGTTACATTTATTTTCTGGG - Intergenic
1183874230 22:40765395-40765417 GAAGGTTACTTTTTTTTTGCGGG + Intergenic
1183946506 22:41329239-41329261 AAAGCTTAGTTTTGTTTTGTGGG - Intronic
1184657933 22:45951405-45951427 AATGGTTCATTTTATGTTATGGG - Intronic
949180336 3:1122452-1122474 AACGGTTACTTTTATGTCATGGG - Intronic
949393755 3:3592599-3592621 AAGGAATACTTTTATGCTGTTGG + Intergenic
955515285 3:59720402-59720424 AATGGGTACTTTTGTGTTTTAGG - Intergenic
955908787 3:63837255-63837277 AATGGTTATTTTGAAGTTGTGGG - Intronic
955984293 3:64556896-64556918 ACAGGTATCTTTGATGTTGTAGG + Intronic
955998725 3:64705830-64705852 AATGGTTAATTTTATGCTATGGG - Intergenic
956691935 3:71886649-71886671 AAACATTATTTTTATTTTGTGGG - Intergenic
957694647 3:83619070-83619092 GAAGGTAACTTTCATGTTTTAGG - Intergenic
958051377 3:88351470-88351492 AAGGGTAACTTTTTTGTTTTGGG - Intergenic
958629382 3:96667878-96667900 AATGGGTACTCTTTTGTTGTGGG + Intergenic
959132862 3:102379370-102379392 AGAGGTTATTTTCATTTTGTTGG + Intronic
959174208 3:102885041-102885063 AAATCTAACTTTTCTGTTGTAGG - Intergenic
959811389 3:110624202-110624224 AATGGTAAATTTTATGTTATAGG + Intergenic
959903842 3:111689113-111689135 AAAGGTTACTTCTAGTTGGTGGG + Intronic
960165774 3:114399769-114399791 ATAGTTTACTTTTATGTTCTGGG + Intronic
963150774 3:142043550-142043572 AAAGGTTTCTTTTATTTTAATGG + Intronic
963216162 3:142750927-142750949 AAATTTTACTTTTAAGTTCTGGG - Intronic
963911001 3:150818563-150818585 AAAGACTAATTTAATGTTGTTGG - Intergenic
964702302 3:159582120-159582142 ATAGGTTTTTTTTATGTTGTTGG + Intronic
965141604 3:164843699-164843721 AAATCTTGCTTCTATGTTGTTGG - Intergenic
965328761 3:167342987-167343009 AAAGATTAATTTTGTGTTGAGGG - Intronic
966010676 3:175072079-175072101 AGAGCTTATTTTGATGTTGTGGG - Intronic
966136103 3:176699875-176699897 TAAGGTTACATTAATGCTGTGGG - Intergenic
966171234 3:177083653-177083675 AAATGTTAATTTTAAATTGTAGG - Intronic
966472406 3:180305520-180305542 AAAGTGTATTTTTTTGTTGTTGG - Intergenic
970551254 4:17183881-17183903 AATGGTTACTTTCATATTGATGG - Intergenic
970626409 4:17889120-17889142 AAAGGTTTCTTTTCTTTTTTTGG + Intronic
971284622 4:25275720-25275742 ATAGGTTATGTTTATGTTTTAGG - Intronic
971771682 4:30905480-30905502 AAAGGTTTCTTTTATTTTTGTGG - Intronic
971956622 4:33428387-33428409 AAAGGTTTCTAATATCTTGTGGG - Intergenic
972167403 4:36304343-36304365 AACGTTTACTTTTATGCTGTTGG - Intronic
972483636 4:39522042-39522064 AAAGTTTACTTTTAGGTACTAGG + Intronic
973824327 4:54690039-54690061 GAATGTTACTTTTTTTTTGTGGG + Intronic
975208743 4:71674442-71674464 AAATGTAAATTTTATGCTGTGGG + Intergenic
975936751 4:79590870-79590892 AAAAGTTAGATTTTTGTTGTAGG + Intergenic
977490959 4:97710733-97710755 AGAAGTTACTTTTAAGTTGATGG - Intronic
978243734 4:106548452-106548474 ATAGGTAAATTTTATGTCGTGGG - Intergenic
979235039 4:118390208-118390230 AAGGGTAATTTTTATGATGTGGG + Intergenic
980296725 4:130928627-130928649 TAAGGTTATTATTATGTTATTGG - Intergenic
980525213 4:133981211-133981233 AAAGTTAACTTTTATGTCATTGG + Intergenic
980707083 4:136512624-136512646 AAAGTTTCCTTTTTTATTGTAGG - Intergenic
980810911 4:137878576-137878598 ATAGGCTACTTTTATTTTCTGGG - Intergenic
981189565 4:141845977-141845999 AAAGGTTGCTATTCTATTGTAGG - Intergenic
982045896 4:151445377-151445399 GAAGGTTCCATTTATGTAGTAGG + Intronic
982154207 4:152499706-152499728 AAAGTTAACTTTTGTGTTTTGGG - Intronic
982533271 4:156575053-156575075 ATAGGTTATTTTTATATTCTGGG - Intergenic
982641950 4:157973004-157973026 AAAAGTTAGTTTTTTGTTTTTGG + Intergenic
983355293 4:166649122-166649144 AAATGTTACTTCTATGTTCATGG + Intergenic
983523826 4:168739381-168739403 AAAGGGAACTTATATATTGTTGG - Intronic
983662853 4:170147911-170147933 AAAGGGAACTTATATATTGTTGG - Intergenic
983866787 4:172776605-172776627 AAGGGATACTTTTAAGATGTTGG + Intronic
984094586 4:175418715-175418737 AGGGGTTACTTTTATAATGTAGG - Intergenic
984568299 4:181358249-181358271 AAAGGTGACATTTTTGTTGGAGG + Intergenic
985258017 4:188088795-188088817 CAATTTTATTTTTATGTTGTGGG + Intergenic
985436392 4:189933888-189933910 AAAGTTTACTTTGATGAAGTTGG - Intergenic
985813297 5:2106745-2106767 AACTGTTAATTTTATGTTGTTGG - Intergenic
986896806 5:12381164-12381186 AAAGTTTTCTTTTTCGTTGTTGG + Intergenic
987856756 5:23428999-23429021 AAAGCTTGGTTTTATGTGGTAGG + Intergenic
988180079 5:27779552-27779574 AAAGGTTAATTTTATAATATTGG - Intergenic
988303897 5:29469701-29469723 AAAGTTTACTTGTATTTGGTTGG + Intergenic
988338244 5:29934657-29934679 AAAGGTCATTTTTAAATTGTTGG - Intergenic
988379622 5:30483063-30483085 AAAATATACTTTTATCTTGTGGG + Intergenic
989022608 5:37027450-37027472 ATAGGTTAGTTTTTTGTTGTTGG + Intronic
989770520 5:45139569-45139591 AAAGGTTATTTTTATGTAAATGG - Intergenic
989984531 5:50682363-50682385 AAATGTTACTTTCATGTTCTTGG - Intronic
990152048 5:52829596-52829618 AAAGGATATTTATCTGTTGTGGG + Intronic
990292700 5:54369679-54369701 AAAAGTTACTACTATGTTATTGG - Intergenic
990345761 5:54869650-54869672 ACAGGATACTTTTAGGTTTTTGG - Intergenic
990617314 5:57521071-57521093 AATGGGTACTCTTTTGTTGTGGG + Intergenic
990965812 5:61446480-61446502 TAAGATTAATTTAATGTTGTTGG - Intronic
991210038 5:64093333-64093355 AAATTTTACTTTAATGTGGTAGG + Intergenic
992344664 5:75864730-75864752 CAAGGTTACTTTTACTTTGAAGG - Intergenic
993074516 5:83211630-83211652 ATAGGTTTCTTTTCTTTTGTTGG - Intronic
993456717 5:88135812-88135834 AACCTTTACTTTTATGTTGCTGG + Intergenic
993816390 5:92552587-92552609 AAAAGTTACATTTGTGTTGTGGG + Intergenic
994066349 5:95546682-95546704 AAAGCTTATTTTTATGCTGATGG - Intronic
995125730 5:108575611-108575633 AATGGGTACTCTTTTGTTGTGGG + Intergenic
995314695 5:110755443-110755465 TAAGTTTATTTTTATGTTTTAGG + Exonic
995975527 5:118031446-118031468 AAAGGAAACTTATATGCTGTTGG + Intergenic
996129221 5:119760901-119760923 AAAGCTTAATTTTAGGTTGAGGG + Intergenic
996297899 5:121945013-121945035 AAATGATCCTTTTATGTTTTGGG + Intergenic
996882801 5:128320080-128320102 AAAGGTGTCTTTTATTGTGTTGG + Intronic
997112966 5:131095424-131095446 TAATTTTACTTTTATGTTCTGGG + Intergenic
999508390 5:152222182-152222204 AAAGGTAACCTTTATTTTGCTGG - Intergenic
999586133 5:153091470-153091492 AATGCTTACTTTTATGATATTGG - Intergenic
999983190 5:156977429-156977451 TATGGTTATTTTTATGTGGTAGG + Intergenic
1000247624 5:159461920-159461942 AAAGGTTAATTTTTTTTTTTTGG - Intergenic
1000728286 5:164800241-164800263 AAAGGATAATCTTATTTTGTTGG + Intergenic
1000818073 5:165948573-165948595 AAAGGTTTATTTTAAGTTTTTGG - Intergenic
1003815939 6:9840265-9840287 AATGGAAACTTTTATGATGTGGG - Intronic
1004124794 6:12862812-12862834 CAAGGTTATTTATATATTGTAGG - Intronic
1004356556 6:14934207-14934229 GCAGGTGACTTTTATGGTGTTGG + Intergenic
1004529985 6:16445140-16445162 TAAGTTTTATTTTATGTTGTAGG - Intronic
1007259037 6:40549485-40549507 AAAGGTTGTCTTTTTGTTGTAGG - Intronic
1008760114 6:54843962-54843984 AAAGGTTGTTTTCAAGTTGTTGG - Intergenic
1008963820 6:57293946-57293968 AAATTATACTTTTAAGTTGTAGG - Intergenic
1009044678 6:58224016-58224038 AATGGTAAATTTTATGTTATTGG + Intergenic
1009220498 6:60978287-60978309 AATGGTAAATTTTATGTTATTGG + Intergenic
1010310662 6:74381171-74381193 AAAGAATACTTTTACATTGTTGG - Intergenic
1010556919 6:77293613-77293635 AGAAGTTACATTTATCTTGTGGG - Intergenic
1010967282 6:82225647-82225669 TAAAGTTAATTTTATTTTGTAGG - Exonic
1011329571 6:86188566-86188588 ATAGTTTACTTTTCTGTTGTAGG + Intergenic
1012086985 6:94840307-94840329 AAAGGTTATTTATATATTATGGG - Intergenic
1012559271 6:100559386-100559408 AATGGTTATTTTTCTTTTGTGGG - Intronic
1013202479 6:107912875-107912897 AAAGTTTGTTTTTGTGTTGTGGG - Intronic
1013607859 6:111766945-111766967 ATTGGTTACTTTGATATTGTAGG - Intronic
1013839915 6:114379099-114379121 AAAGGGTACTTTCCTTTTGTAGG + Intergenic
1013880976 6:114900292-114900314 AAATGTAGCTTTTTTGTTGTTGG - Intergenic
1014598023 6:123369624-123369646 GCAGCTTACTTTTATGTTGTAGG - Intronic
1014811918 6:125896284-125896306 AAAGGATACTCTTATGCTGGTGG - Intronic
1016116873 6:140297658-140297680 TAAGGTTTCATTTCTGTTGTTGG + Intergenic
1016680615 6:146824986-146825008 ACAGGTTACAATTATGTTGGGGG - Intergenic
1017742035 6:157415193-157415215 TAAAGTTCCTTTTATGTTCTGGG + Intronic
1018250162 6:161861573-161861595 AAATTTTACTTTTAAGTTCTGGG - Intronic
1018583630 6:165332596-165332618 CAATGTTGCTTTGATGTTGTTGG - Exonic
1018595524 6:165476372-165476394 AAAGGTTACTTCTGTATTTTGGG - Intronic
1018958535 6:168430377-168430399 CAAGGGTTCTTTTATATTGTAGG - Intergenic
1019998912 7:4743564-4743586 AATGGTGAATTTTATGTTATGGG + Intronic
1020424752 7:8052372-8052394 AAAGGTTGTTCTTAAGTTGTGGG + Intronic
1020854600 7:13402426-13402448 AAAATTTAGTTTTATGTGGTAGG + Intergenic
1021863418 7:24930443-24930465 AAAGTTTACTTTTTTTTTCTTGG - Intronic
1021892560 7:25200282-25200304 AAATGGTACTATTATGCTGTGGG - Intergenic
1023702019 7:42902078-42902100 AAAGGTTCATTTGATGTTATTGG + Intergenic
1026174656 7:67985818-67985840 TAAGGTTACTTTAAAGCTGTGGG - Intergenic
1026265683 7:68794191-68794213 AATGGTTAATTTAATGTTATAGG + Intergenic
1026269475 7:68823728-68823750 AGAGGTGACTCTTATCTTGTAGG + Intergenic
1028656636 7:93216008-93216030 AAAGTGTACCTTTATGGTGTTGG - Intronic
1031043772 7:116864626-116864648 AAAGGTTATTTTCATTTTGGGGG + Intronic
1031271847 7:119660395-119660417 AAATGTTAGTTTTTTGTTGGTGG + Intergenic
1031864459 7:127023095-127023117 AAAGGATACTTTTATGTTTTCGG + Intronic
1033123986 7:138691092-138691114 AATGGTGACTTTTATGTAGGTGG + Intronic
1033435312 7:141328440-141328462 AAAAGTCACTTTGATGTGGTTGG + Intronic
1033669856 7:143481463-143481485 AAAGAGTTCTTTTATGTTGATGG - Intergenic
1033966377 7:146979992-146980014 AAAGGTTACATTTATCAGGTTGG - Intronic
1036583169 8:10096445-10096467 AAAGGTGATTTTTATGATGTTGG + Intronic
1036719374 8:11158894-11158916 AGAGGTTCATTTTATGTTCTTGG - Intronic
1036747811 8:11422694-11422716 AGAGGTTGCTTTTCTTTTGTGGG - Exonic
1037210586 8:16381868-16381890 AAAGGTTTCTATTAGGTGGTAGG + Intronic
1040677859 8:49772359-49772381 AAATTTTACTTCTATGTGGTAGG - Intergenic
1041148024 8:54899089-54899111 ATAGCTTAATTTGATGTTGTGGG - Intergenic
1042260571 8:66855055-66855077 AAGGGTTACTTTTAGGTTCCTGG - Intronic
1042268681 8:66934777-66934799 AAAGGTGACTTTTGTCTTTTGGG - Intergenic
1042345409 8:67721777-67721799 AAAAGTTACTTTTTTATGGTAGG + Intronic
1042493546 8:69430353-69430375 AAATTCTATTTTTATGTTGTTGG - Intergenic
1043251244 8:78076370-78076392 AAAGTTTCCATTTATCTTGTTGG - Intergenic
1043384675 8:79736640-79736662 AAAATTTACTTATATGTTCTAGG - Intergenic
1043696753 8:83229415-83229437 AAAAGTTACTTGTATTTTGGGGG - Intergenic
1043830027 8:84977166-84977188 TATGGTTGCTTTTATGTTCTGGG + Intergenic
1044810476 8:96056280-96056302 AACAGTTGCTTTTATGTAGTAGG + Intergenic
1045158538 8:99508588-99508610 AAATGTGACTTTTGTGTTGGAGG + Intronic
1046144148 8:110135163-110135185 ATAGCTTATTTTTATGTTTTTGG - Intergenic
1046267595 8:111850762-111850784 AAACCTTACTTTTTTGATGTAGG + Intergenic
1047132257 8:122034807-122034829 AAATTTTACTTTTAAGTTCTGGG + Intergenic
1047357128 8:124133130-124133152 AAAGCTTATTTGTATGTGGTGGG - Intergenic
1048886199 8:138911925-138911947 AATGGTCACTTTGATATTGTTGG - Intronic
1049135432 8:140893762-140893784 AATGGTGAATTTTATGTTATGGG + Intronic
1049168515 8:141142163-141142185 AAAGGATGCTTTTGTGATGTTGG + Intronic
1050211751 9:3267254-3267276 AAAGGTTACTTTTATGTTGTGGG - Intronic
1050646292 9:7723252-7723274 AAGGAATACTTTTATGCTGTTGG - Intergenic
1051064565 9:13087132-13087154 AAAGGTAACTTATATGTACTGGG + Intergenic
1051072929 9:13194693-13194715 AAATTTTACTTTTAAGTTCTAGG - Intronic
1051177044 9:14371270-14371292 AGGTTTTACTTTTATGTTGTAGG + Intronic
1052359610 9:27539922-27539944 AAAGGTTTATTTTACGTAGTGGG + Intergenic
1053623374 9:39843368-39843390 CAAGGTTAGTTTTCTGATGTTGG + Intergenic
1053881494 9:42599860-42599882 CAAGGTTAGTTTTCTGATGTTGG - Intergenic
1053891171 9:42694452-42694474 CAAGGTTAGTTTTCTGATGTTGG + Intergenic
1054220525 9:62407331-62407353 CAAGGTTAGTTTTCTGATGTTGG - Intergenic
1054230190 9:62501841-62501863 CAAGGTTAGTTTTCTGATGTTGG + Intergenic
1054844118 9:69774681-69774703 AAGGGTGAATTTTATGTTTTGGG - Intergenic
1054856301 9:69903131-69903153 AGATGTGACTTTTATGGTGTTGG + Intronic
1054936102 9:70689458-70689480 AAAAGTTAGTGTTATGCTGTAGG + Intronic
1055705592 9:78998150-78998172 AATGTTTAGTTTGATGTTGTTGG + Intergenic
1055884323 9:81041737-81041759 AAAGGTTACTTTTTCCTTGATGG + Intergenic
1057058313 9:91981005-91981027 AATGGGTACTCTTTTGTTGTGGG - Intergenic
1058290644 9:103236715-103236737 AAAGTTTACATTTATGTAATAGG - Intergenic
1058537978 9:105981755-105981777 AAAGGATGCTTTTACATTGTGGG - Intergenic
1058663733 9:107289511-107289533 AAAGGTTACTTTGATGCTGTGGG + Intronic
1058854984 9:109052911-109052933 AAAGGTTACTTTTTTGTTGTTGG - Intronic
1062728658 9:138096081-138096103 AATGGGTAATTGTATGTTGTGGG + Intronic
1186245763 X:7615141-7615163 AAAGGTCACTGTGATTTTGTAGG + Intergenic
1187275305 X:17811548-17811570 AAAGGTTAAATTTTTGTTCTGGG + Intronic
1189205748 X:39237256-39237278 ACTGGTTCATTTTATGTTGTAGG + Intergenic
1192331701 X:70180550-70180572 AACGGTAAATTTTATGTTCTAGG - Intronic
1192364442 X:70459390-70459412 AATGGTTACTTAAATGTTATGGG - Intronic
1192894014 X:75420965-75420987 AAAGATTAATTTGAGGTTGTAGG - Intronic
1193099878 X:77597818-77597840 AAAGGGAACATTTATGTTGGTGG + Intronic
1193937000 X:87635696-87635718 AATGGATTCTTATATGTTGTAGG + Exonic
1194663497 X:96652181-96652203 ATAGATTAGTTTTATGTTTTTGG + Intergenic
1195051039 X:101097361-101097383 AAAGTTTAAGTTTATGTAGTTGG - Intergenic
1195082198 X:101382069-101382091 AAAGGTTGCTTTGTTGCTGTGGG - Intronic
1195106682 X:101609744-101609766 AAAGGTTACTTTTAAGGTGATGG - Intergenic
1195630756 X:107053175-107053197 AATGGGTACTCTTTTGTTGTGGG + Intergenic
1195901221 X:109799616-109799638 AAATGTTACTCTTTTGTTATGGG - Intergenic
1196231709 X:113231512-113231534 TATGGTTACTTTTATTATGTAGG + Intergenic
1197021389 X:121693784-121693806 AATGTATACTTATATGTTGTTGG + Intergenic
1197786573 X:130203787-130203809 CAAGGTTACTTTCTTGTTTTTGG - Exonic
1197786593 X:130204092-130204114 CAAGGTTACTTTCTTGTTCTTGG - Exonic
1198652911 X:138883366-138883388 AAAGCTTTCTTTTATGAGGTAGG - Intronic
1198869927 X:141167137-141167159 AAAGGTTAATTGTATGGTATGGG + Intergenic
1200838881 Y:7759972-7759994 AAATGTTATTTTAATGTTTTAGG - Intergenic
1201409704 Y:13687053-13687075 AAAGCTTGCTTTTATGTTTTAGG + Intergenic
1201772849 Y:17634329-17634351 AAAGTTTACTTTTATTTTTGAGG + Intergenic
1201828706 Y:18271657-18271679 AAAGTTTACTTTTATTTTTGAGG - Intergenic