ID: 1050211752

View in Genome Browser
Species Human (GRCh38)
Location 9:3267255-3267277
Sequence CAAAGGTTACTTTTATGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050211752_1050211756 -5 Left 1050211752 9:3267255-3267277 CCACAACATAAAAGTAACCTTTG 0: 1
1: 0
2: 2
3: 22
4: 237
Right 1050211756 9:3267273-3267295 CTTTGTAGGTTCTCTATAATGGG No data
1050211752_1050211755 -6 Left 1050211752 9:3267255-3267277 CCACAACATAAAAGTAACCTTTG 0: 1
1: 0
2: 2
3: 22
4: 237
Right 1050211755 9:3267272-3267294 CCTTTGTAGGTTCTCTATAATGG No data
1050211752_1050211758 0 Left 1050211752 9:3267255-3267277 CCACAACATAAAAGTAACCTTTG 0: 1
1: 0
2: 2
3: 22
4: 237
Right 1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG No data
1050211752_1050211757 -4 Left 1050211752 9:3267255-3267277 CCACAACATAAAAGTAACCTTTG 0: 1
1: 0
2: 2
3: 22
4: 237
Right 1050211757 9:3267274-3267296 TTTGTAGGTTCTCTATAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050211752 Original CRISPR CAAAGGTTACTTTTATGTTG TGG (reversed) Intronic
902157359 1:14499249-14499271 CTAAGCTTTCTTTTATGTTTGGG - Intergenic
903390806 1:22962504-22962526 CAATGGTAAATTTTGTGTTGGGG + Intronic
904692250 1:32302269-32302291 CGATGGTTATTTTTCTGTTGTGG + Intronic
905618412 1:39418168-39418190 CAAGGGTGACTTTTAGGTTCTGG + Intronic
908430549 1:64052630-64052652 CAAAGGATACTTTTTAGCTGTGG - Intronic
909127928 1:71698542-71698564 TAAATGTTACTTTTCTTTTGGGG + Intronic
910679697 1:89850008-89850030 CAAAGGTTACTCTTATTATTTGG + Intronic
911537847 1:99122032-99122054 AAAAGGAAACTTTTATGTTTAGG - Intergenic
912964455 1:114225435-114225457 GACTGGTTACTTTTTTGTTGTGG + Intergenic
913573671 1:120147196-120147218 TTACGATTACTTTTATGTTGTGG - Intergenic
914294928 1:146311999-146312021 TTACGATTACTTTTATGTTGTGG - Intergenic
914555969 1:148762782-148762804 TTACGATTACTTTTATGTTGTGG - Intergenic
915642732 1:157241716-157241738 CCAAGGTTCTTATTATGTTGAGG - Intergenic
916335541 1:163666947-163666969 CAAAGGTAAATATTATCTTGTGG - Intergenic
917506322 1:175630176-175630198 GATAGGTTACTTTTATGCTCTGG + Intronic
917626539 1:176852090-176852112 TGAAGGTCAGTTTTATGTTGAGG + Intergenic
917673485 1:177297335-177297357 CAAAGTTTTCTTTTAGTTTGAGG - Intergenic
918209153 1:182335686-182335708 CAAAGGCTGCTTTTCTGATGAGG - Intergenic
919620376 1:199858357-199858379 CAAAGGGTACTATGGTGTTGTGG + Intergenic
921766746 1:218981889-218981911 CAAAGTTTCCTTATATCTTGAGG + Intergenic
923482918 1:234401518-234401540 AAAAGGTGACTTTTATGTAATGG - Intronic
923519559 1:234725302-234725324 CAAAGGTTACTTAGAAGTGGAGG + Intergenic
923711198 1:236388076-236388098 CAAAGCTTACTTTTGTGTATAGG + Intronic
924675781 1:246176414-246176436 CAAATGTTACTTTTTTGTTACGG - Intronic
1063675388 10:8136911-8136933 CAGAGGTTACTCTTCTGGTGGGG - Intergenic
1063738461 10:8790050-8790072 CACAGCTTATTTTTATGTTCAGG + Intergenic
1067566543 10:47342735-47342757 TAAAAGTTATTTTTATGTTCTGG - Intergenic
1068092243 10:52446943-52446965 CAAAGATTACTTTTATTTAAGGG + Intergenic
1068133210 10:52921368-52921390 AAATGGTTATTTTTATATTGAGG - Intergenic
1068162531 10:53284136-53284158 GAAAGGTTACTTTTAAGATCTGG + Intergenic
1068212783 10:53942894-53942916 CAAATATTAGTTTTGTGTTGTGG - Intronic
1069126119 10:64636551-64636573 CATAGGGTAATTTTATGTTTAGG + Intergenic
1070671272 10:78379035-78379057 CAAAAGCTACTGTTATTTTGGGG + Intergenic
1071970453 10:90900735-90900757 CAAAGGTTTTATTTTTGTTGTGG - Intronic
1075855406 10:125625439-125625461 CAAAGGTTATTTTGATGTTCTGG + Intronic
1079953722 11:26836544-26836566 AAAATGTAACTTTTATGTTTTGG - Intergenic
1081183929 11:40019090-40019112 CAAAGATTAATTCTTTGTTGTGG - Intergenic
1088205662 11:107389202-107389224 CAATGGTTACTTTTTGGTAGTGG - Intronic
1088219874 11:107558498-107558520 CAAAGGTTTCATTGGTGTTGAGG + Intronic
1089050621 11:115542341-115542363 CAAAGGTTATTTTATTTTTGTGG + Intergenic
1092874859 12:12839070-12839092 CAAAGGTCACTTTTATTTTCTGG - Intergenic
1092917341 12:13200785-13200807 CAAGGTTTTCTTTTGTGTTGTGG + Intronic
1093495436 12:19751792-19751814 CAATTGATACTTTTTTGTTGAGG + Intergenic
1093654902 12:21683451-21683473 CAAATTTTACTTTTGTGTTCAGG - Intronic
1094570061 12:31633699-31633721 CAAAGATTAATTTTTTTTTGTGG + Intergenic
1094667760 12:32538229-32538251 TACAGGTTATTTTTTTGTTGTGG + Intronic
1096918889 12:55062864-55062886 CAAAGGATACATTTATGTCAGGG + Intergenic
1096947675 12:55425978-55426000 CATAGTTTACATTTATTTTGGGG - Intergenic
1097642670 12:62201380-62201402 AAAAGGTTCTTTTTATTTTGAGG + Intronic
1098312870 12:69164979-69165001 CAAAAGTTACCTATAGGTTGAGG + Intergenic
1098575203 12:72033898-72033920 CAAATGCTATTTTTTTGTTGAGG - Intronic
1099273694 12:80548235-80548257 CAATGGTTAATTTTTTTTTGAGG + Intronic
1099692192 12:85970363-85970385 CAAAATTTAGTTTTATCTTGTGG + Exonic
1101116128 12:101533160-101533182 CAAAGGTTATTTGTTTGTTTTGG - Intergenic
1102728600 12:115088393-115088415 CAAACATTGCTTTTATCTTGAGG - Intergenic
1106260714 13:28064177-28064199 CAAAGGTTCTTTTTATATTAGGG - Intronic
1106985369 13:35341512-35341534 TAAGGGTTACTTTTATATTCTGG - Intronic
1107142264 13:37013745-37013767 CAAAAGTTACATTTATCTTGAGG + Intronic
1107333682 13:39330146-39330168 CAAAGCTAAGTTTCATGTTGGGG + Intergenic
1107535101 13:41321580-41321602 TAAAAGCTACTTTTATGTTTAGG - Intronic
1109707071 13:66109791-66109813 CAAAAGTTAATTTTAGGATGCGG - Intergenic
1110106850 13:71687901-71687923 TAAAAGTTTGTTTTATGTTGGGG - Intronic
1110307173 13:74002312-74002334 CAAATGTTACTTTTATTTTCTGG - Intronic
1110348644 13:74479367-74479389 CAAAGGTTACTGATATGGTTTGG - Intergenic
1110877158 13:80524054-80524076 CAAAGGTGACTCTTATATTCTGG - Intergenic
1111960196 13:94801715-94801737 CAAATGTTCCTTTTGTGTTTTGG + Intergenic
1113078312 13:106490604-106490626 CAGAAGTTACTTTTAGGATGGGG - Exonic
1115610992 14:35048493-35048515 CAAAGGTAACTATTAAGTTTTGG + Intronic
1117204070 14:53423259-53423281 CAAACCTTACTTTTATTTTATGG - Intergenic
1117249291 14:53919476-53919498 AAGAGGTTGCTTTTATGTTCTGG + Intergenic
1117262854 14:54054706-54054728 CTAAGCCTACTTTTATGTTCAGG + Intergenic
1118790599 14:69088471-69088493 GAAATGTTAATTTTATTTTGAGG + Intronic
1120501264 14:85300070-85300092 GAAATGTTACTTTTATGTTGGGG - Intergenic
1121850516 14:97218254-97218276 CAAAGGGGGCTTTTATGTTACGG + Intergenic
1122665025 14:103323488-103323510 TAAAGGCTACTTGTATGTTTGGG - Intergenic
1123676933 15:22719097-22719119 GAAAGGTTAATTATATGTTGAGG + Intergenic
1124329150 15:28793375-28793397 GAAAGTTTAATTATATGTTGAGG + Intergenic
1125065087 15:35472997-35473019 CAAAAGAAACTTTTAAGTTGAGG - Intronic
1125452817 15:39826611-39826633 AAAAGGTTACATTAATGTAGAGG - Intronic
1127243287 15:57142690-57142712 AAAAGGTAACTTTTCAGTTGAGG + Intronic
1127249856 15:57221648-57221670 CAAAGGTGACTTTTATGTTCTGG + Intronic
1127442262 15:59021468-59021490 CAAAGATTACATTTATTTTTAGG + Intronic
1128432481 15:67610629-67610651 CATTGGTTACTTTGATGTAGGGG + Intronic
1130201777 15:81836609-81836631 AAAAGGTTACTGCTATGTTGGGG - Intergenic
1131728967 15:95259110-95259132 CAAAACTTATTTTTAGGTTGAGG + Intergenic
1132176511 15:99720041-99720063 TAAGGGTTACTTTTATATTAGGG + Intronic
1134284122 16:12845299-12845321 CAAAGGTTACTTTTATTAGAGGG + Intergenic
1134776815 16:16860384-16860406 CAAGGGTCACTTTTATGCCGGGG - Intergenic
1134923849 16:18141105-18141127 CAAAGGAAACTTTTTTTTTGTGG - Intergenic
1135189599 16:20344085-20344107 CAAAGTTGATTTTGATGTTGAGG + Exonic
1135783151 16:25323992-25324014 TAAAGGTGACTTTCAGGTTGTGG + Intergenic
1136746129 16:32593776-32593798 CAAATGTTACCTGGATGTTGTGG - Intergenic
1137917831 16:52452281-52452303 CAATGTTTACTTTTGTATTGTGG - Intronic
1138871369 16:60891561-60891583 CTAAAGTTATTTTTATGTGGTGG + Intergenic
1140390959 16:74586206-74586228 CCCAGGTTCCTTTTATCTTGTGG - Intronic
1203048256 16_KI270728v1_random:852980-853002 CAAATGTTACCTGGATGTTGTGG - Intergenic
1142814800 17:2416755-2416777 CAGAGGTCACATTCATGTTGCGG - Exonic
1145967955 17:28934043-28934065 CCAAGGCTACTTTTTTTTTGAGG - Intronic
1146039733 17:29439971-29439993 AAAAGATTACTTTTAGGTTGAGG - Intronic
1146537566 17:33666364-33666386 CAGAAGGTACTTTTAGGTTGGGG + Intronic
1149288969 17:55197300-55197322 CATTGGTCACTTTCATGTTGAGG - Intergenic
1150531811 17:65991527-65991549 TATAGGTTACTTTTATATTCTGG + Intronic
1153928091 18:9853097-9853119 TAAAGGTTACTTATATATTTTGG + Intronic
1155280170 18:24231241-24231263 CAAAGTTTGCTTTAATGTTATGG + Intronic
1155626196 18:27837805-27837827 AAAAGGTTAATTTTATTTGGGGG + Intergenic
1159350386 18:67265113-67265135 CATAGGTTACTTTTGGCTTGGGG - Intergenic
1165421517 19:35724343-35724365 CAAAAGTTAGTTGTATGTGGTGG + Intronic
1165529352 19:36384984-36385006 CAATACTTACTTTTATTTTGTGG + Intronic
1167667397 19:50830759-50830781 CCAAGGTGACCTTGATGTTGTGG + Intronic
1168504058 19:56918168-56918190 CAAAGCTTGCTTTTACCTTGGGG - Intergenic
924971740 2:134240-134262 CACTGGCTACTTTTATGTTGTGG - Intergenic
925554667 2:5116816-5116838 GAAAGGTTAAATTTAGGTTGGGG + Intergenic
929351419 2:40960463-40960485 GAAAGGTAACGTTTATGATGTGG - Intergenic
930491617 2:52080703-52080725 CAAATGATACTTTTAGGATGGGG - Intergenic
930553644 2:52868372-52868394 CAATTGTTACTTTTATACTGAGG - Intergenic
930643004 2:53873614-53873636 AAAAGGTAACTTTTGTGGTGAGG - Intronic
931001352 2:57787066-57787088 TAAAGGTTACATTTATATTTAGG - Intergenic
935146883 2:100401659-100401681 TAAATGTTGCTTTTAGGTTGAGG - Intronic
935512938 2:103998546-103998568 TAAAAGTTACTTTTATTCTGTGG + Intergenic
936780712 2:116029421-116029443 AAATGGTGAATTTTATGTTGTGG - Intergenic
936839177 2:116749088-116749110 CAAAGGTTATTTCTAAATTGGGG + Intergenic
936941490 2:117888846-117888868 TAAAGGTCATATTTATGTTGGGG - Intergenic
939728189 2:145749960-145749982 AAAAGGTTACTGTAATTTTGTGG - Intergenic
940443619 2:153749968-153749990 CATATATTGCTTTTATGTTGAGG + Intergenic
941411517 2:165162354-165162376 AACAGGTCACTTTTATGTTTTGG - Exonic
943359743 2:186902855-186902877 AAAAGGAGACATTTATGTTGAGG + Intergenic
943600549 2:189915249-189915271 CAAAGGTTATTTTTAGGAAGAGG - Intronic
946480121 2:220047512-220047534 TAAAGGTTACTTTGATGTCCGGG - Intergenic
946842843 2:223835836-223835858 CAAAGGCTGCTTTTGTGCTGAGG - Intronic
947644995 2:231732186-231732208 CAAAGGGTGCATGTATGTTGTGG + Intergenic
1169107701 20:3011017-3011039 CAAAAGTTAATTGTATGTTAAGG + Intronic
1170188705 20:13622027-13622049 GAAAGGTTAATTATATGTTGAGG - Intronic
1170979836 20:21201205-21201227 CAAAGTTTACTATTATCATGTGG + Intronic
1174227558 20:49014505-49014527 CATATGTCACTTTTATGTTGCGG - Intronic
1177275633 21:18909474-18909496 TTAAGGTTACTTATATATTGAGG + Intergenic
1178145688 21:29737093-29737115 CATAGGTGACTTTCATATTGTGG - Intronic
1178531404 21:33379387-33379409 CAAAGAATACTTTTTTGTTTTGG + Intergenic
1182989889 22:34757361-34757383 CAAATGTTACATTTATTTTCTGG - Intergenic
1183874229 22:40765394-40765416 TGAAGGTTACTTTTTTTTTGCGG + Intergenic
949180337 3:1122453-1122475 CAACGGTTACTTTTATGTCATGG - Intronic
949308959 3:2674190-2674212 AAAAGGCTACTTTTATTATGAGG - Intronic
949755294 3:7402631-7402653 CAAAGGTCACTTTTATATGCAGG - Intronic
950293107 3:11803520-11803542 CAAAGGTTAATTCTATTTTTAGG - Intronic
951615379 3:24537652-24537674 GAAAGGTTTCTTTTATGTTTTGG + Intergenic
951945695 3:28133395-28133417 CAAAAGCTGCTTTTATTTTGAGG + Intergenic
953003328 3:38954686-38954708 CCAATGTTACTTTTAAGATGTGG - Intergenic
955530436 3:59867068-59867090 TAGAGGCTACTTTTATGGTGTGG - Intronic
956159994 3:66340606-66340628 CAAGGCTTATTTTTATGCTGTGG + Intronic
956978638 3:74611929-74611951 CTAATGTTAATTTTATGTAGTGG - Intergenic
957181426 3:76883248-76883270 CAAAGTAGACTTTTATGCTGTGG - Intronic
957202547 3:77155452-77155474 TAAAGGTTACTTTTATTTCCTGG - Intronic
957984198 3:87551508-87551530 CAAAAGTTACGTATAGGTTGAGG - Intergenic
958051378 3:88351471-88351493 CAAGGGTAACTTTTTTGTTTTGG - Intergenic
959117077 3:102191145-102191167 CAAAGGAGTCTGTTATGTTGAGG + Intronic
960165773 3:114399768-114399790 AATAGTTTACTTTTATGTTCTGG + Intronic
960398846 3:117170941-117170963 CAAAGTTTATTTTTGTGTTCTGG - Intergenic
962058527 3:131900443-131900465 CCTAGGTTACCTTTATGTGGAGG - Intronic
962877034 3:139543017-139543039 CAAAGAACAATTTTATGTTGGGG + Intergenic
962954403 3:140250863-140250885 CAAAGGTTGCTTTTTTTTGGTGG + Intronic
963427821 3:145154859-145154881 CAAGGGTTACTTTTATAATATGG - Intergenic
965328762 3:167342988-167343010 AAAAGATTAATTTTGTGTTGAGG - Intronic
965374776 3:167909720-167909742 CAAAGCTTTCTTTGAAGTTGGGG - Intergenic
966233454 3:177674243-177674265 CAAAGGATACTTTTTTGGTGAGG + Intergenic
967809023 3:193739999-193740021 TAAAGGTTATTTGTATGTTTTGG + Intergenic
968122882 3:196138438-196138460 TAAAGGTTAATTTTAAGTGGTGG - Intergenic
969366862 4:6700642-6700664 CAAAGGGTAATTTTTTATTGTGG + Intergenic
971424720 4:26504479-26504501 CAAATGTTCCTGTTCTGTTGTGG - Intergenic
971956623 4:33428388-33428410 CAAAGGTTTCTAATATCTTGTGG - Intergenic
975405559 4:73984797-73984819 CTAAGGTTAATTTATTGTTGAGG + Intergenic
976492672 4:85690004-85690026 CATAGATGACTTTTATTTTGAGG + Intronic
976590159 4:86841912-86841934 CAAGGGTAACATTTATATTGAGG - Intronic
978798735 4:112734077-112734099 CAGAGATTACTTATATGATGTGG + Intergenic
979235038 4:118390207-118390229 CAAGGGTAATTTTTATGATGTGG + Intergenic
979611640 4:122695547-122695569 AAAAGGTTACTGTTATGGTTTGG + Intergenic
979916788 4:126445213-126445235 CAAAGGTGACTTTTACTTTGGGG + Intergenic
980042840 4:127959301-127959323 CAAAGGATAGTTTTAGGTTAGGG + Intronic
981355135 4:143781201-143781223 CAAAGGTAACATTTGTGTTTTGG - Intergenic
983352532 4:166610346-166610368 AAAAGTTTATTTTTTTGTTGTGG + Intergenic
984554688 4:181199651-181199673 CAAAGGATAGTGTCATGTTGGGG + Intergenic
987739643 5:21890009-21890031 CAAAGGTTCATTCTATGTTTCGG + Intronic
987803829 5:22735173-22735195 CATAGGTTTGTATTATGTTGAGG - Intronic
990152047 5:52829595-52829617 CAAAGGATATTTATCTGTTGTGG + Intronic
991155835 5:63433927-63433949 TTAATGTTATTTTTATGTTGGGG + Intergenic
993625227 5:90216097-90216119 CAAAAGTGACTTTTATTTGGTGG - Intergenic
993816389 5:92552586-92552608 AAAAAGTTACATTTGTGTTGTGG + Intergenic
996129220 5:119760900-119760922 TAAAGCTTAATTTTAGGTTGAGG + Intergenic
996789238 5:127274792-127274814 TAAAGATGACTTTTATGTTCAGG + Intergenic
997167023 5:131672176-131672198 CAAAGGTTACTTTCCTGATTGGG - Exonic
998970964 5:147592310-147592332 CAATGGTTACAATTTTGTTGGGG - Intronic
999542160 5:152585548-152585570 TATAAGTTTCTTTTATGTTGTGG + Intergenic
999669453 5:153945772-153945794 CAAAGGTGACTCTTTTGTTATGG - Intergenic
999844607 5:155465509-155465531 CAAAGGTAACTTTTTAGTTTAGG + Intergenic
1000604047 5:163309252-163309274 AAAAGCTTACTTTTTTGTTAAGG + Intergenic
1001538659 5:172521005-172521027 CAAAGGTTTTTTTTTTTTTGAGG + Intergenic
1001720569 5:173853712-173853734 CAAAGGTTATTTTTATCTCGGGG + Intergenic
1003389077 6:5697862-5697884 CAAGTGTTGCTTTTAAGTTGAGG - Intronic
1003815940 6:9840266-9840288 CAATGGAAACTTTTATGATGTGG - Intronic
1004439175 6:15630935-15630957 CAAAGGTAACTTTGTTGTTTAGG - Intronic
1004972408 6:20925294-20925316 TAAAAGTTATTTTTATGCTGTGG - Intronic
1005486067 6:26300887-26300909 AAAAGGTTACTCTTCTTTTGAGG - Intergenic
1005814476 6:29539588-29539610 CAAAGTTTGCTTTTATGAAGAGG - Intergenic
1006305224 6:33214491-33214513 AAAACGTTACTATTTTGTTGAGG + Intergenic
1006883034 6:37355658-37355680 AAAGGGTTACTTGTATGCTGTGG + Intronic
1009291168 6:61884662-61884684 CAAAGGTTACTGTTATGTGCAGG - Intronic
1010392224 6:75350582-75350604 CACAGAGTACTTTTATGTTCAGG - Intronic
1010556920 6:77293614-77293636 CAGAAGTTACATTTATCTTGTGG - Intergenic
1011572114 6:88748965-88748987 GAAAGGTTACCTTTCTTTTGGGG + Intronic
1012883775 6:104821672-104821694 CAATGTTTACTTATGTGTTGGGG - Intronic
1012917314 6:105184330-105184352 AGATGGTTACTTTTATGTTATGG - Intergenic
1013202480 6:107912876-107912898 CAAAGTTTGTTTTTGTGTTGTGG - Intronic
1014491646 6:122069657-122069679 CTGAGGTTAATTTTATGTTATGG - Intergenic
1015412957 6:132915126-132915148 CAAAGCTTACTTTCTGGTTGGGG + Intergenic
1015457047 6:133438282-133438304 CCAAGGCTATTTTTATTTTGAGG + Intronic
1016630536 6:146224911-146224933 CAAAGCTGACTTTTCTCTTGGGG + Intronic
1016680616 6:146824987-146825009 CACAGGTTACAATTATGTTGGGG - Intergenic
1016727312 6:147388697-147388719 CAAATATTAATTTTATTTTGGGG + Intergenic
1018296140 6:162346246-162346268 CAAAGGTTATTTTTAAGATTGGG - Intronic
1020826286 7:13033326-13033348 CAAAAGTTACTTTTTTATTTAGG - Intergenic
1021892561 7:25200283-25200305 CAAATGGTACTATTATGCTGTGG - Intergenic
1022332526 7:29394035-29394057 CAAACGTTTCTATTGTGTTGAGG - Intronic
1027380009 7:77597734-77597756 TAAAGATTAATTTTATATTGTGG + Intronic
1028463753 7:91125635-91125657 CAAAGGTTACTTTTCCATTTAGG + Intronic
1030041505 7:105454906-105454928 GCAATGATACTTTTATGTTGAGG + Intronic
1031043771 7:116864625-116864647 TAAAGGTTATTTTCATTTTGGGG + Intronic
1033001214 7:137507308-137507330 CATAATTTACTTTTATCTTGTGG - Intronic
1036671812 8:10794322-10794344 CAAAAGTTACTTTTCTGTGTAGG - Intronic
1038620047 8:29133855-29133877 CAAAAGTTACCTTTGGGTTGTGG + Intronic
1041320714 8:56609779-56609801 CAAAAGTTACTTACAGGTTGGGG - Intergenic
1042669194 8:71242343-71242365 CAAAAGTTGATTTTATGTTAGGG - Intronic
1043696754 8:83229416-83229438 AAAAAGTTACTTGTATTTTGGGG - Intergenic
1043711862 8:83430147-83430169 CCAAGGTTACTTATCTTTTGAGG - Intergenic
1045261949 8:100583594-100583616 TAAAGTTTAATTTTATATTGAGG + Intronic
1045964500 8:108009065-108009087 TAAACGTTAATTTTATGTAGGGG - Intronic
1046338071 8:112815873-112815895 CAAAGATTATTTTTGTATTGTGG + Intronic
1048849727 8:138633142-138633164 GAAAGGTTAATTTTCTGCTGTGG + Intronic
1050211752 9:3267255-3267277 CAAAGGTTACTTTTATGTTGTGG - Intronic
1051308733 9:15746409-15746431 TAAAGATTATTTTTAAGTTGTGG + Intronic
1051538408 9:18186538-18186560 CAAAGTCTACTTTTATGGTGGGG - Intergenic
1054916486 9:70499328-70499350 CAATGTTTACTTATATGTTGTGG + Intergenic
1055481845 9:76716531-76716553 CTAAGGGGACTTTTATGATGAGG - Intronic
1057600597 9:96453661-96453683 CAAAGGTCAATTTTATTTTGTGG + Intronic
1057850950 9:98566330-98566352 TGAAGGTTACTATTTTGTTGAGG - Intronic
1058333191 9:103790638-103790660 CAAATATTGCTTTTATGCTGAGG - Intergenic
1058663732 9:107289510-107289532 TAAAGGTTACTTTGATGCTGTGG + Intronic
1185774944 X:2794530-2794552 CACAGGTTACTTCAATGATGTGG + Exonic
1186059563 X:5689574-5689596 CAAAGATTATTTTTAGGTTAAGG + Intergenic
1187275304 X:17811547-17811569 CAAAGGTTAAATTTTTGTTCTGG + Intronic
1187311914 X:18152877-18152899 CAAAGGTTACTGATATATTTGGG - Intergenic
1188558071 X:31434347-31434369 CAAAGGTCACTTTTATTGGGAGG + Intronic
1188871567 X:35379853-35379875 ACATGTTTACTTTTATGTTGGGG + Intergenic
1192837853 X:74821007-74821029 CAAAGTTTTATTTTAGGTTGAGG - Intronic
1192905507 X:75546556-75546578 CACAGGGTACTTTTTTGATGTGG + Intergenic
1194010744 X:88558114-88558136 AAAAGGTTACCTTTAAGGTGAGG - Intergenic
1194246684 X:91521137-91521159 CATACTTGACTTTTATGTTGAGG + Intergenic
1194749981 X:97673360-97673382 TAGACATTACTTTTATGTTGTGG + Intergenic
1194903800 X:99548043-99548065 TAAACATTACTTTTATTTTGTGG - Intergenic
1195677644 X:107519528-107519550 AAATGGTAACTTTTATGTTATGG + Intergenic
1196857071 X:119994289-119994311 CTAAAGTTTCTTTTTTGTTGTGG - Intergenic
1198182961 X:134227342-134227364 CAAAAGTTCCTTTAATGTGGAGG + Intergenic
1200565643 Y:4762405-4762427 CATACTTGACTTTTATGTTGAGG + Intergenic
1202183209 Y:22157152-22157174 CAATGGTGACTTTCATGGTGAGG + Intergenic
1202208150 Y:22429249-22429271 CAATGGTGACTTTCATGGTGAGG - Intergenic