ID: 1050211758

View in Genome Browser
Species Human (GRCh38)
Location 9:3267278-3267300
Sequence TAGGTTCTCTATAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050211751_1050211758 1 Left 1050211751 9:3267254-3267276 CCCACAACATAAAAGTAACCTTT 0: 1
1: 1
2: 3
3: 25
4: 369
Right 1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG No data
1050211750_1050211758 10 Left 1050211750 9:3267245-3267267 CCTGAAGCACCCACAACATAAAA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG No data
1050211752_1050211758 0 Left 1050211752 9:3267255-3267277 CCACAACATAAAAGTAACCTTTG 0: 1
1: 0
2: 2
3: 22
4: 237
Right 1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050211758 Original CRISPR TAGGTTCTCTATAATGGGGT AGG Intronic
No off target data available for this crispr