ID: 1050211758 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:3267278-3267300 |
| Sequence | TAGGTTCTCTATAATGGGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050211751_1050211758 | 1 | Left | 1050211751 | 9:3267254-3267276 | CCCACAACATAAAAGTAACCTTT | 0: 1 1: 1 2: 3 3: 25 4: 369 |
||
| Right | 1050211758 | 9:3267278-3267300 | TAGGTTCTCTATAATGGGGTAGG | No data | ||||
| 1050211750_1050211758 | 10 | Left | 1050211750 | 9:3267245-3267267 | CCTGAAGCACCCACAACATAAAA | 0: 1 1: 0 2: 2 3: 18 4: 209 |
||
| Right | 1050211758 | 9:3267278-3267300 | TAGGTTCTCTATAATGGGGTAGG | No data | ||||
| 1050211752_1050211758 | 0 | Left | 1050211752 | 9:3267255-3267277 | CCACAACATAAAAGTAACCTTTG | 0: 1 1: 0 2: 2 3: 22 4: 237 |
||
| Right | 1050211758 | 9:3267278-3267300 | TAGGTTCTCTATAATGGGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050211758 | Original CRISPR | TAGGTTCTCTATAATGGGGT AGG | Intronic | ||
| No off target data available for this crispr | |||||