ID: 1050219633

View in Genome Browser
Species Human (GRCh38)
Location 9:3372657-3372679
Sequence CTGGAGGCAGAGGTTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2527
Summary {0: 1, 1: 1, 2: 32, 3: 378, 4: 2115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050219633_1050219641 18 Left 1050219633 9:3372657-3372679 CCTGCCTCAACCTCTGCCTCCAG 0: 1
1: 1
2: 32
3: 378
4: 2115
Right 1050219641 9:3372698-3372720 GCCTCAGCCTCCCGAGCAGCTGG 0: 2560
1: 104770
2: 266022
3: 219174
4: 198698
1050219633_1050219643 19 Left 1050219633 9:3372657-3372679 CCTGCCTCAACCTCTGCCTCCAG 0: 1
1: 1
2: 32
3: 378
4: 2115
Right 1050219643 9:3372699-3372721 CCTCAGCCTCCCGAGCAGCTGGG 0: 2765
1: 111227
2: 293718
3: 226548
4: 225970
1050219633_1050219645 27 Left 1050219633 9:3372657-3372679 CCTGCCTCAACCTCTGCCTCCAG 0: 1
1: 1
2: 32
3: 378
4: 2115
Right 1050219645 9:3372707-3372729 TCCCGAGCAGCTGGGAGTACAGG 0: 17
1: 3277
2: 112251
3: 293131
4: 245529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050219633 Original CRISPR CTGGAGGCAGAGGTTGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr