ID: 1050222561

View in Genome Browser
Species Human (GRCh38)
Location 9:3410558-3410580
Sequence GCAGCAAATAAGTGTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050222560_1050222561 14 Left 1050222560 9:3410521-3410543 CCAAAATAAACAGGGAACAAATT 0: 1
1: 0
2: 7
3: 40
4: 519
Right 1050222561 9:3410558-3410580 GCAGCAAATAAGTGTAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050222561 Original CRISPR GCAGCAAATAAGTGTAATTT TGG Intronic
No off target data available for this crispr