ID: 1050230921

View in Genome Browser
Species Human (GRCh38)
Location 9:3525589-3525611
Sequence CCGCTGCGGCGCCGCCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050230921_1050230929 21 Left 1050230921 9:3525589-3525611 CCTCGGCGGCGGCGCCGCAGCGG 0: 1
1: 0
2: 7
3: 58
4: 366
Right 1050230929 9:3525633-3525655 GACCCCAGCACAGCCACACTCGG 0: 1
1: 0
2: 4
3: 56
4: 569
1050230921_1050230924 -7 Left 1050230921 9:3525589-3525611 CCTCGGCGGCGGCGCCGCAGCGG 0: 1
1: 0
2: 7
3: 58
4: 366
Right 1050230924 9:3525605-3525627 GCAGCGGCAGCCCCCGTGTCAGG 0: 1
1: 0
2: 1
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050230921 Original CRISPR CCGCTGCGGCGCCGCCGCCG AGG (reversed) Intronic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900382495 1:2391809-2391831 CCTCCGCGGCGCCGCCTCCAGGG - Intronic
901066642 1:6497458-6497480 CCGCGGCGGCCCCGCCTCGGGGG + Intronic
901641316 1:10694517-10694539 CGGCCGCGGCGCCGCCTCCTCGG + Intronic
902169497 1:14598784-14598806 CCGCCGCCTCGCCACCGCCGCGG + Exonic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903750176 1:25616685-25616707 CGGCTGCGGCGCGGCGGCGGCGG + Intergenic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
905580772 1:39081631-39081653 GAGCTGGGGCGCGGCCGCCGGGG - Intronic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
910597097 1:88992455-88992477 TCGCTGCGGGGCCGCCTGCGGGG - Intronic
910679087 1:89843982-89844004 GCGCTGCGGAGCCGCCTGCGAGG + Intronic
912401555 1:109397743-109397765 CCGCTGCGCCGCTGCCGCGCTGG - Exonic
912514838 1:110211013-110211035 CTGCTGCGCTGCCGCCGCTGCGG + Intergenic
912915639 1:113812057-113812079 CGGCTGCGACGCCGCCGGTGAGG + Exonic
914286155 1:146228794-146228816 CTCCTCCGCCGCCGCCGCCGCGG + Exonic
914702933 1:150150342-150150364 CCGCCGCGGCGCCGACGGAGCGG - Intronic
914702934 1:150150342-150150364 CCGCTCCGTCGGCGCCGCGGCGG + Intronic
914902361 1:151717488-151717510 CGCCCGCGGCGCCGCCTCCGCGG - Intronic
914911427 1:151790500-151790522 CGGCTGAAGCGCCGCCGGCGGGG - Intronic
915302970 1:154961989-154962011 CCGCGGCGGCTCCACCGCCCGGG - Intronic
916120486 1:161524598-161524620 CTGCTGCCGCTCCGCCGTCGAGG - Exonic
916130250 1:161606230-161606252 CTGCTGCCGCTCCGCCGTCGAGG - Intronic
918015934 1:180632401-180632423 CCACTGCGGCATCCCCGCCGCGG + Intronic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
918064263 1:181089090-181089112 CTGCTGCGGTGGCGGCGCCGGGG - Exonic
919820545 1:201469265-201469287 CCGCTGCGGCCCCGCCCCCGGGG - Intergenic
920216293 1:204363440-204363462 CCCCTGCGGCTCCTCCACCGAGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920805779 1:209232055-209232077 CAGCTGGGCCGGCGCCGCCGGGG + Intergenic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
922819065 1:228471425-228471447 CGGCTCCGGTGCCGCCTCCGTGG + Intergenic
923171497 1:231421628-231421650 CGGCTGCAGTGCCGCCGCCCAGG - Exonic
924560832 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG + Intronic
1065100377 10:22325589-22325611 CCGCGCCGGCCCCGCCCCCGCGG + Intronic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1065140533 10:22714656-22714678 CGGCTGCGGCGCCGCGGGCGGGG + Intergenic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066126325 10:32346578-32346600 CCGCTGGGCCGCGGCGGCCGGGG + Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071618081 10:87094638-87094660 CCGCCGCCGCCCCGCAGCCGGGG - Exonic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1073049186 10:100656687-100656709 CCGCTGCGCCCCGCCCGCCGCGG - Intergenic
1074121735 10:110498358-110498380 CGGCGGCGGCGTCGCGGCCGTGG + Exonic
1075144652 10:119872763-119872785 CGGCTGCGGTGGGGCCGCCGAGG + Intronic
1075645516 10:124093496-124093518 CCTCTGCGGCTCCGGCTCCGCGG + Exonic
1076890704 10:133281834-133281856 GCCCTGCGGCGCCGGCTCCGGGG - Intronic
1076898442 10:133325473-133325495 TCGCTGCAGCCCCGCCCCCGTGG - Exonic
1077021071 11:417400-417422 CCGGGGCTACGCCGCCGCCGGGG - Intronic
1077124359 11:925914-925936 CCGCCGCGGAGGAGCCGCCGGGG - Exonic
1077361836 11:2144324-2144346 CCGCGGCCGAGCCGCCACCGGGG + Intronic
1078246221 11:9574540-9574562 CCCCTCCGGCGCCGCGGCCCCGG - Intronic
1079297008 11:19242370-19242392 CCGAGGCAGCGCCGCCGCCCCGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080418650 11:32091646-32091668 CCGCCGCCGCGCCCCGGCCGGGG + Intronic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083168388 11:60906274-60906296 CCGCTGCGGCGCCCGGGCCGGGG - Intronic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083885754 11:65572733-65572755 CCGCTGCCGCGCGGCCTCAGCGG + Exonic
1083893248 11:65607332-65607354 CCGCACGTGCGCCGCCGCCGCGG - Exonic
1083922315 11:65787507-65787529 CCGCAGCCTCGACGCCGCCGCGG - Intronic
1084680027 11:70661731-70661753 CCGCGGCCGCTCCTCCGCCGGGG + Exonic
1085044013 11:73343108-73343130 CCGCTGGGGCGGGGGCGCCGGGG - Intronic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1087172819 11:95067608-95067630 CGGCTGCGGTGTCGCCGCCTGGG - Exonic
1088480965 11:110296350-110296372 CGGCCGTGGCGCCGCCGCCAGGG - Intronic
1091498322 12:991332-991354 CCGCGCTGTCGCCGCCGCCGCGG - Intronic
1092743058 12:11649042-11649064 CGTCTGCGGCGCGGCCGCCCCGG + Intergenic
1092894923 12:13001594-13001616 CCGGTTCGGCGCCACCGTCGGGG - Intergenic
1094041111 12:26122617-26122639 CCGCCGCCGCGCCGCCCCCCGGG + Exonic
1096365489 12:51025892-51025914 CCCCTGCGGCGCCGACGAAGAGG + Intronic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1096786851 12:54021760-54021782 CGGCTGCGGCGCCGTGGCAGAGG - Intronic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1100830939 12:98516098-98516120 CGGCTCTGGGGCCGCCGCCGCGG + Exonic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101682906 12:106986911-106986933 CCGCTGCGGCGCCGCTGGTGAGG + Exonic
1102136921 12:110583112-110583134 CCGCAGTCGCGCCGCCGCTGGGG + Exonic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1102913594 12:116737261-116737283 CTTCTGCAGCGGCGCCGCCGGGG - Intronic
1103899225 12:124294983-124295005 CCGGCCCGGCGCCTCCGCCGAGG - Intronic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104939032 12:132386311-132386333 CGGCTGCGGCTCCGAGGCCGGGG - Intergenic
1106517167 13:30465403-30465425 CCGCGCCGGCCCCGCCGCCCCGG + Intronic
1106602497 13:31199988-31200010 CCGCCGCCGCCCTGCCGCCGCGG - Exonic
1110573012 13:77026777-77026799 CCGCTGCGACGGCGGAGCCGGGG - Intronic
1112504971 13:99970092-99970114 CGGCGGCGGCGGCGCGGCCGGGG + Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112506991 13:99981403-99981425 CCGCCCCGGCGCCCCCGCCGCGG + Intergenic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1115664802 14:35534666-35534688 CCACGGCGGCGGCGCCCCCGGGG - Exonic
1115752330 14:36505501-36505523 CAGCCGCGGCTCCGCCGTCGGGG - Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1116950167 14:50872139-50872161 CCGATACGCCGCCACCGCCGCGG - Exonic
1118607599 14:67515085-67515107 CCGGTGCGGGGCCGGGGCCGTGG + Exonic
1119249037 14:73136551-73136573 CCGCCGCCCCGCTGCCGCCGCGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1122221169 14:100239799-100239821 CCGCGCCGGCCCCGCCGCTGAGG - Exonic
1122436807 14:101706267-101706289 CCGTGGCGGCGCCGCCCCGGAGG + Intergenic
1123500803 15:20878790-20878812 CTCCTGCGGCGCCGCAGCCTGGG - Intergenic
1123558054 15:21452483-21452505 GCCCTGCGGCGCCGCAGCCTGGG - Intergenic
1123594282 15:21889764-21889786 GCCCTGCGGCGCCGCAGCCTGGG - Intergenic
1124500381 15:30223111-30223133 CGGCTGCGGCGCTGGCCCCGCGG - Intergenic
1124743192 15:32315555-32315577 CGGCTGCGGCGCTGGCCCCGCGG + Intergenic
1125200754 15:37099072-37099094 CTGCTGCGCCGCTGCCGCCGTGG - Intronic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125541190 15:40471036-40471058 CCGCTTCGGCGCCGCAGCCCGGG + Exonic
1125999312 15:44194742-44194764 CCGGTGTGTCACCGCCGCCGCGG - Intronic
1126150939 15:45522951-45522973 CCACTGCGCCGCCTCCGCCCAGG + Intergenic
1126634183 15:50765603-50765625 CCGCCGCTGCGCTGCCTCCGTGG + Exonic
1127071259 15:55289949-55289971 CCTCGGAGGCGCGGCCGCCGGGG - Intronic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1129764068 15:78149809-78149831 CCGCAGCAGGGCCGCAGCCGGGG - Intronic
1130023644 15:80251957-80251979 CCGCTGCCGCGGCGCCTGCGGGG - Intergenic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130352930 15:83107532-83107554 CCGCTGAGGGGACGCCGCTGAGG + Exonic
1130517151 15:84634103-84634125 CCGCTGCAGCGCCGCCGTCCAGG + Intergenic
1131517712 15:93089846-93089868 CCGCGGGGGAGCCGCGGCCGTGG - Intergenic
1132028534 15:98422059-98422081 CCGGTGCGCCGCCGCCGATGGGG + Intergenic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132079490 15:98852345-98852367 CCGCGCCCGCGCCGCCGCCGTGG + Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1202966404 15_KI270727v1_random:179655-179677 GCCCTGCGGCGCCGCAGCCTGGG - Intergenic
1132544563 16:527409-527431 CCGCTGATGCGCAGACGCCGCGG + Intergenic
1132868746 16:2106235-2106257 CTGCTGCGGCGCTGTCGCCAGGG - Exonic
1133156480 16:3880203-3880225 CCGCCGGGGCGCCCCCACCGCGG - Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1134164035 16:11915853-11915875 CTGCTGCCGCGGCGACGCCGGGG - Exonic
1136365558 16:29807544-29807566 CGGCGGCGGCGCTGCCGCAGTGG + Exonic
1136861550 16:33707235-33707257 CCGCGCCTGCGCCGCCGCCGTGG + Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1136913439 16:34161914-34161936 CCGCCGTGGCTTCGCCGCCGCGG - Intergenic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139534452 16:67562810-67562832 CGGCGCCAGCGCCGCCGCCGGGG + Intronic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1140529038 16:75648247-75648269 CCGCTGCGGCTCCGGCTCCGCGG - Exonic
1141526947 16:84617911-84617933 CCGCTGCGGCTCCGCGGCGATGG - Exonic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1142399181 16:89850435-89850457 CGGCTGCGGTGCCGCCGATGAGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1144109998 17:12021459-12021481 CCACTGCGGCGGCGGGGCCGAGG - Intronic
1144656891 17:17042607-17042629 CCGCCGCCGCCCGGCCGCCGCGG - Intronic
1144682764 17:17206306-17206328 CCGCTGCGGCGGCGTGGCTGTGG - Exonic
1144836170 17:18157825-18157847 CCGCGGCCGAGCAGCCGCCGTGG + Exonic
1145031529 17:19507986-19508008 CCGCTGCGGCGCCGCAGTTCAGG + Intronic
1145765621 17:27456620-27456642 CCGCCGCGGCCCCGATGCCGAGG + Intergenic
1146371121 17:32266099-32266121 CTGGAGCGGCGCGGCCGCCGCGG + Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147044835 17:37744564-37744586 CCGCTGCTCCGCCGCCTCCTCGG + Exonic
1147150267 17:38510188-38510210 CCGCTCCTCCGGCGCCGCCGGGG - Exonic
1147636465 17:41967213-41967235 CCGCTTCGGCGCCCCCTCCCCGG + Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147994587 17:44353893-44353915 CGGCTGCGGCCCCGCCCCCGGGG + Exonic
1148755768 17:49972245-49972267 GCGCTGCGGTGCCGCCGCGGGGG - Intronic
1150267884 17:63842608-63842630 CAGCCACGGCGCCGCCGCCAGGG + Exonic
1151780180 17:76240356-76240378 CCGCTGCGGCGCTGCGGCTCTGG + Exonic
1151780200 17:76240424-76240446 CCGCGGCGGCGCCTCTGCCAAGG + Intergenic
1151857891 17:76736441-76736463 CGGCTGCGGCGACGCCGCCTAGG + Exonic
1152463744 17:80454592-80454614 CCGCTTCGGGGCCGACCCCGGGG + Intergenic
1152627968 17:81396915-81396937 GCGCTGCGGCGCCGTCCTCGCGG + Intronic
1153488823 18:5628751-5628773 CCGCCCTGGCGCCGCCGCTGCGG - Intronic
1153553243 18:6284542-6284564 CCGCCGCAGCGCCGCCACCTTGG + Intronic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1156275692 18:35581394-35581416 CCGCTGCGGCGAGCCCACCGCGG - Intronic
1157384094 18:47247594-47247616 CCGAGGCCGCGCCCCCGCCGGGG - Intronic
1157753012 18:50194986-50195008 CCGTAGCTGCGCCGCCGCGGCGG - Exonic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158434950 18:57428800-57428822 CGGCTGCGGCGTCGAGGCCGCGG - Intergenic
1160453599 18:78980679-78980701 CCGCCGCCGCGCCGCCCCCCAGG + Intronic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160708110 19:539317-539339 CCTCTGCGGTGCCGTCCCCGGGG + Intronic
1160719235 19:590156-590178 CGGCTGCGGAGCCGGCCCCGCGG - Exonic
1160766586 19:811277-811299 CAGCTGGGGCGCGGCGGCCGCGG + Exonic
1160794974 19:941044-941066 CCGCGGGGTCACCGCCGCCGCGG + Intronic
1160921802 19:1524151-1524173 CGACTCCTGCGCCGCCGCCGCGG - Intronic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161115577 19:2494910-2494932 CCACTGGGGCCCCGGCGCCGGGG + Intergenic
1161241116 19:3224581-3224603 CCGCTGCGGAGCCGCCTTTGTGG + Intergenic
1161304065 19:3557359-3557381 CCGGAGCGGCGCCGTCCCCGCGG - Exonic
1161306927 19:3573591-3573613 TCGCTGCAGCCCCGCCGTCGGGG + Intronic
1162296673 19:9818708-9818730 CAGGTGCGGCCCCGCCTCCGGGG - Exonic
1162772376 19:12957005-12957027 GCGTTACGGCGCCGCCTCCGGGG - Exonic
1162954333 19:14090070-14090092 CTGCTGTGGCGGCGCCGGCGGGG + Exonic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1163583788 19:18153450-18153472 CCGCTGCGGAGCCGAGCCCGAGG - Intronic
1164658544 19:29942330-29942352 CCGCTGCGGGGCGGCGGCGGCGG + Exonic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1165956953 19:39507076-39507098 CCGCTGCCGCGCCGGCTTCGCGG + Exonic
1166100364 19:40567988-40568010 CCGCACCTGCTCCGCCGCCGCGG - Exonic
1166984146 19:46649581-46649603 CTGCGCAGGCGCCGCCGCCGGGG - Exonic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
1168073073 19:53963343-53963365 CCGAGGCGCCGCCGCCCCCGCGG - Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168314130 19:55476713-55476735 CAGCTGCACCGCCGCTGCCGGGG + Exonic
1168336497 19:55600292-55600314 CCCCCGCCTCGCCGCCGCCGAGG + Intronic
1202683212 1_KI270712v1_random:29117-29139 CTTCTGCGCCCCCGCCGCCGAGG + Intergenic
927168588 2:20350333-20350355 CCTCTGCGGGGCCGCCGCCTCGG - Intronic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927606576 2:24491529-24491551 CCGGGGCGGCGCCGCCGCCACGG + Intergenic
927606575 2:24491529-24491551 CCGTGGCGGCGGCGCCGCCCCGG - Intergenic
927713817 2:25340906-25340928 ACATTGCGGCGCCGCCACCGCGG + Intronic
929966847 2:46542851-46542873 CCGGGGCGCTGCCGCCGCCGCGG - Exonic
930358251 2:50346960-50346982 CCGCCGAGGGGCAGCCGCCGCGG + Intronic
931348718 2:61470488-61470510 GCGCGGTGGCGCGGCCGCCGCGG - Intronic
932566888 2:72916354-72916376 CCGCTTCCTCGCCGCTGCCGGGG - Intronic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
933666981 2:84971628-84971650 CCGCGGCGCCGCTGCCGCCACGG + Intronic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934661333 2:96145173-96145195 CTGCTGCGGCGCCGCGCGCGCGG - Exonic
934882359 2:97995444-97995466 CCGCCGCAGGGACGCCGCCGGGG + Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
942277853 2:174335935-174335957 CCGGTGCGGCGACTCCTCCGCGG + Intronic
942947321 2:181684302-181684324 CCGACGCGGCGCCTCCGCCCCGG + Intergenic
944579045 2:201116504-201116526 CAGCTCCGGCGCCGCCAGCGCGG - Intronic
946322471 2:218961807-218961829 CCACTGAGGCGCCGCGGCCGGGG - Exonic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948479340 2:238240239-238240261 CCGCCCCGGTGCCGCCCCCGCGG - Intronic
1168802629 20:653180-653202 CCCCATCGTCGCCGCCGCCGCGG + Exonic
1170991189 20:21303260-21303282 ACGTCACGGCGCCGCCGCCGGGG - Intergenic
1170998697 20:21391809-21391831 AAGCTGCGGCGCCGCGGACGAGG - Intergenic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172474483 20:35226750-35226772 CCGGCGCGGCGCGGCCGCCCCGG - Exonic
1173726035 20:45298374-45298396 TCGCTACGGCACCGCAGCCGAGG - Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176194430 20:63830898-63830920 CAGCTGCGGCGCGGGCTCCGGGG - Intronic
1176207206 20:63895476-63895498 CTGCTGCGACGCCGCGGCCTGGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1177920301 21:27143751-27143773 CCGCAGCGGCGCCTCGGCCCCGG - Intergenic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1180614773 22:17120233-17120255 CCGCGGGGGCGCCGGCGGCGCGG - Exonic
1180614905 22:17120695-17120717 CGGCGGGGGCGCCGCGGCCGGGG - Exonic
1180650018 22:17369697-17369719 AGGCTGCGGCGCTGCCGCGGCGG + Exonic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1180874711 22:19169751-19169773 CCGCTGCGGGGCTGAAGCCGCGG + Intergenic
1181083802 22:20430067-20430089 GCGCTGCGGCGCGGCCACCACGG - Intronic
1181270819 22:21657619-21657641 CCGCACCTGCGCCGCGGCCGTGG + Intronic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1182586323 22:31346097-31346119 CCGCTCCGGCGCCCCCGCCCCGG - Exonic
1183540750 22:38428074-38428096 CGGTTGCGGCGCTTCCGCCGGGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183912949 22:41092442-41092464 CCGGTGCGGCGGCGGCGGCGCGG + Exonic
1184510192 22:44928892-44928914 CCGCTGAGGCCCCACTGCCGGGG + Intronic
1184759488 22:46536744-46536766 GCGCGGCCGCGCAGCCGCCGGGG + Exonic
1185055240 22:48575801-48575823 CCGCACCATCGCCGCCGCCGGGG - Intronic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185388982 22:50548792-50548814 CCGCCGCAGGGCTGCCGCCGTGG - Exonic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
950153834 3:10708003-10708025 CGGCTGCGGCTCCTCTGCCGCGG + Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950940370 3:16885054-16885076 CCGGGGGGGCGCCGCCGGCGGGG + Intronic
951217763 3:20040597-20040619 CCCCTGCGCCGCTGCCGCCGGGG + Exonic
953627296 3:44581235-44581257 CCGCCGCCGCCCAGCCGCCGTGG + Intronic
953972223 3:47356316-47356338 CCACTGGGGTGCCGCCGCCTGGG - Intergenic
954256577 3:49411716-49411738 CCGGTGGGGCGCGGCCGCGGCGG + Intronic
955763815 3:62319000-62319022 CAGCTACTGCGCCGACGCCGGGG - Intronic
956678190 3:71754300-71754322 GCCCGGCGGCGCCCCCGCCGCGG - Exonic
958091893 3:88886831-88886853 CTGCTGCGGCGCGTCCGCCACGG + Intergenic
958470200 3:94507625-94507647 GCGCTGCGGCTCTGCCGCGGCGG - Intergenic
959984952 3:112561926-112561948 CCGTAGCTGCGCCGCCACCGGGG + Exonic
961377308 3:126475598-126475620 GCACGGCGGCGCTGCCGCCGAGG - Exonic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
963939921 3:151087180-151087202 CCGCTCGGTCTCCGCCGCCGGGG - Intronic
966866438 3:184261225-184261247 CCGCTTCGGCGCAGACCCCGAGG - Exonic
967867735 3:194204153-194204175 CGGCTCCAGCGCCGCCCCCGCGG - Intergenic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
968144687 3:196288156-196288178 ACGCTGCGGCGAGGCAGCCGCGG - Intronic
968225614 3:196970116-196970138 GCACTCCCGCGCCGCCGCCGAGG + Intergenic
968372752 4:11005-11027 CCGCCGCGGCGCCGTGGCGGTGG + Intergenic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745792 4:159103340-159103362 CCCCGGCGCCGGCGCCGCCGCGG - Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
985462642 4:190121561-190121583 CCGCCGCGGCGCCGTGGCGGGGG - Intergenic
987085152 5:14461153-14461175 CCGCTGCTGAGCCGCCGCACGGG - Exonic
992563245 5:77972899-77972921 CCGGCGCGGCGCGGCCCCCGGGG + Intergenic
992716307 5:79514223-79514245 CCGCCGCGGAGCCGCGGCCGGGG + Intergenic
992940039 5:81751838-81751860 CCGCTGCGGTGGCGGCGCCCGGG + Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
997402359 5:133612506-133612528 CTGCTGTGCCACCGCCGCCGCGG + Exonic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
998193046 5:140043096-140043118 CCGCTCAGCCGCCGCCGCCTTGG + Exonic
998797530 5:145835523-145835545 CCGCTCTGGCGCCGCCAGCGTGG - Intergenic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002029383 5:176416591-176416613 GCCCTGCGGCCCCGCCCCCGCGG - Intergenic
1003107470 6:3227469-3227491 CCGCTGCGGCGCGCCCACCTTGG + Exonic
1004044727 6:12012581-12012603 CAGCTGCAGCGCCCCCGCCGCGG - Intronic
1004193872 6:13487271-13487293 GGGCTGCGGCGGCGCGGCCGCGG - Exonic
1004720429 6:18264162-18264184 CCGCTCCGCCGCCGCCGTCCAGG + Intronic
1005928971 6:30466617-30466639 CCGCCGCGGCGCCGACAGCGAGG + Intergenic
1006096716 6:31660787-31660809 GAGCTGCGGCACCGCCCCCGCGG - Intergenic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1007630260 6:43269534-43269556 CCCCTGCGGCGCCGGCGTCCCGG - Intronic
1007630308 6:43269753-43269775 CCGAGGAGCCGCCGCCGCCGGGG - Intronic
1008649073 6:53544969-53544991 CCGCCGCGGCAGCGCGGCCGTGG - Exonic
1013009575 6:106107137-106107159 GCGCTGCGGCCCCGGCGCCTGGG + Exonic
1013170819 6:107635022-107635044 CACGCGCGGCGCCGCCGCCGAGG + Exonic
1013242803 6:108261289-108261311 CCGCCGCGGGGCTGCGGCCGAGG + Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1018531212 6:164765313-164765335 CCGCTGCGGAGCGGCAGCAGGGG + Intergenic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1020347631 7:7182654-7182676 CCGCTGTGCTGCCGCTGCCGGGG + Exonic
1021828056 7:24573763-24573785 CGGCGGCGGCGCCGCGGTCGGGG + Intronic
1022285968 7:28956540-28956562 CCCCTCCGTCGCTGCCGCCGCGG - Exonic
1022363357 7:29685001-29685023 CCGCCGCGGCGCCGCCGGGCTGG + Intergenic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1023758824 7:43444891-43444913 CCTCTGCCGCGCTGCCGCCCTGG - Exonic
1026734848 7:72942914-72942936 CCGCTGAGGGGCAGCCACCGGGG + Exonic
1026785181 7:73297826-73297848 CCGCTGAGGGGCAGCCACCGGGG + Intergenic
1027108895 7:75422104-75422126 CCGCTGAGGGGCAGCCACCGGGG - Exonic
1027960507 7:84940020-84940042 CAGCAGCGGCGCCTCCTCCGGGG + Intergenic
1028621432 7:92833340-92833362 CCGCCGCGGCGCCGCTGGGGCGG + Exonic
1029054945 7:97732262-97732284 CCGCAGCGGCGCCCCCAGCGCGG - Intronic
1029813988 7:103075246-103075268 GCGCTGCGGCTCTGCCGCGGCGG + Exonic
1030138607 7:106284264-106284286 CCTCTGCGGCTCCGGCGCGGAGG - Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1034254014 7:149714743-149714765 CCGCTTCCGAGCCGGCGCCGCGG + Intergenic
1034977739 7:155457987-155458009 GGGCTCCGGCGCCGCCGCCTGGG - Intergenic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1036801394 8:11795036-11795058 CCTCCCCCGCGCCGCCGCCGTGG + Intergenic
1039595599 8:38787648-38787670 ACGCGGCGGGGCCGCCGGCGAGG + Exonic
1043296131 8:78665987-78666009 CCGCCGCGGCCCCGCCCCCACGG + Intergenic
1047732436 8:127737954-127737976 CCGCTGCGGGGCCGACTCCCGGG + Intronic
1047951544 8:129939661-129939683 CCGCTGAGGAGCCGCCTCTGCGG - Exonic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049405436 8:142450073-142450095 CAGCAGCGGCCCCGCCGGCGAGG - Exonic
1049574378 8:143383660-143383682 CCGCTCCGGCTCCGGCTCCGTGG - Exonic
1049623438 8:143609522-143609544 CAGCTGCGGAGCCGTCTCCGCGG - Exonic
1049665446 8:143840805-143840827 CCGCCTCGGCGCCGGCTCCGGGG + Exonic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050230922 9:3525589-3525611 CCTCGGCGGCGGCGCCGCAGCGG + Intronic
1051206374 9:14693313-14693335 CTCCTCCGGCGCCGCCGCCCAGG + Exonic
1051418619 9:16870135-16870157 GCGCTGGGGCGCAGCCGCCCGGG - Intronic
1051855428 9:21559637-21559659 CGGCTTCGGCGCCGCGGCCGGGG + Intergenic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1053306217 9:36986353-36986375 CCGCCGCGGCCGCGCCGGCGGGG + Intronic
1056873550 9:90306341-90306363 CCGCTGCAGCCCCGCCCCCTCGG - Intergenic
1057245531 9:93451678-93451700 CCGCTGCGAGGCCGAGGCCGAGG - Intronic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057619216 9:96619762-96619784 CCGCTGCTGCGTAGGCGCCGGGG + Exonic
1058053250 9:100427142-100427164 CCGGTCCGTCGGCGCCGCCGAGG - Intronic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1059234508 9:112750706-112750728 CCGCTCCGGCCCCGCCCCCGAGG - Intergenic
1060152900 9:121299965-121299987 CCCCTGGGGCGCCCCCGCCTGGG - Exonic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1060812687 9:126618955-126618977 ACGCCGCGGCCCCGCCGCCGAGG - Intronic
1061540737 9:131276919-131276941 CTGCTTCGCCGCGGCCGCCGAGG + Intergenic
1061987149 9:134136335-134136357 CCGCTGCAGCGGCCCCGCCCGGG + Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185736622 X:2500831-2500853 CTGCTGCGGCGCTGCCGCGGGGG - Exonic
1185736625 X:2500834-2500856 CAGCTGCTGCGGCGCTGCCGCGG - Exonic
1186496501 X:10015714-10015736 CTCCTTCCGCGCCGCCGCCGCGG + Exonic
1187155808 X:16719701-16719723 CCGCTCGCGGGCCGCCGCCGCGG - Exonic
1187900943 X:24025861-24025883 CCCCCGCGGCGCCGCCGTCGGGG + Intronic
1189323179 X:40098176-40098198 CCGCGGAGGCGCCGCAGCGGAGG - Intronic
1189323181 X:40098179-40098201 CCGCCGCGGAGGCGCCGCAGCGG - Intronic
1189323182 X:40098179-40098201 CCGCTGCGGCGCCTCCGCGGCGG + Intronic
1190008063 X:46758967-46758989 CTACCGGGGCGCCGCCGCCGCGG - Exonic
1190526372 X:51332885-51332907 CCGCTGCCGGGCAGCAGCCGAGG - Exonic
1190581376 X:51894960-51894982 CCGCTGCTGCGCTGCCACCCGGG + Intronic
1192768007 X:74162325-74162347 CAGCTGCGCCGCCACTGCCGTGG + Intergenic
1193655068 X:84188292-84188314 CCGCTGTGCCGCCGCCGTGGGGG - Intergenic
1193655072 X:84188295-84188317 ACGCCGCTGTGCCGCCGCCGTGG - Intergenic
1195668354 X:107449929-107449951 CCGCTGCCGCGCCGCTGAGGAGG + Intergenic
1196425081 X:115561616-115561638 CCACTTCGGGGCCGCAGCCGCGG - Intronic
1197753609 X:129981013-129981035 TCGCTGCCGCCGCGCCGCCGCGG - Intergenic
1200746847 Y:6910817-6910839 CCGCCTCTGCCCCGCCGCCGCGG - Exonic
1201904747 Y:19077125-19077147 CCGCTGCGGTAGCGCCGCCGGGG - Intergenic