ID: 1050231580

View in Genome Browser
Species Human (GRCh38)
Location 9:3531016-3531038
Sequence TTTATATAAAATTTAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050231578_1050231580 8 Left 1050231578 9:3530985-3531007 CCAGACACAGAGTACATAGCATA No data
Right 1050231580 9:3531016-3531038 TTTATATAAAATTTAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050231580 Original CRISPR TTTATATAAAATTTAAGAAC AGG Intergenic
No off target data available for this crispr