ID: 1050237571

View in Genome Browser
Species Human (GRCh38)
Location 9:3597840-3597862
Sequence ATGGGGTGGCTTCCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050237571_1050237576 -8 Left 1050237571 9:3597840-3597862 CCAGCAGAGGGAAGCCACCCCAT No data
Right 1050237576 9:3597855-3597877 CACCCCATGTGGTAAGGCAAGGG No data
1050237571_1050237581 26 Left 1050237571 9:3597840-3597862 CCAGCAGAGGGAAGCCACCCCAT No data
Right 1050237581 9:3597889-3597911 TGCTAGCATGCTGCTGTCCATGG No data
1050237571_1050237577 -7 Left 1050237571 9:3597840-3597862 CCAGCAGAGGGAAGCCACCCCAT No data
Right 1050237577 9:3597856-3597878 ACCCCATGTGGTAAGGCAAGGGG No data
1050237571_1050237582 30 Left 1050237571 9:3597840-3597862 CCAGCAGAGGGAAGCCACCCCAT No data
Right 1050237582 9:3597893-3597915 AGCATGCTGCTGTCCATGGACGG No data
1050237571_1050237575 -9 Left 1050237571 9:3597840-3597862 CCAGCAGAGGGAAGCCACCCCAT No data
Right 1050237575 9:3597854-3597876 CCACCCCATGTGGTAAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050237571 Original CRISPR ATGGGGTGGCTTCCCTCTGC TGG (reversed) Intergenic