ID: 1050245611

View in Genome Browser
Species Human (GRCh38)
Location 9:3686611-3686633
Sequence TCTTTAAAACATTGATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050245611_1050245612 3 Left 1050245611 9:3686611-3686633 CCATCATATCAATGTTTTAAAGA No data
Right 1050245612 9:3686637-3686659 CTTTCTTATAGTGATGAGTACGG No data
1050245611_1050245613 4 Left 1050245611 9:3686611-3686633 CCATCATATCAATGTTTTAAAGA No data
Right 1050245613 9:3686638-3686660 TTTCTTATAGTGATGAGTACGGG No data
1050245611_1050245614 20 Left 1050245611 9:3686611-3686633 CCATCATATCAATGTTTTAAAGA No data
Right 1050245614 9:3686654-3686676 GTACGGGTTGCTAAAGACTTTGG No data
1050245611_1050245615 23 Left 1050245611 9:3686611-3686633 CCATCATATCAATGTTTTAAAGA No data
Right 1050245615 9:3686657-3686679 CGGGTTGCTAAAGACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050245611 Original CRISPR TCTTTAAAACATTGATATGA TGG (reversed) Intergenic
No off target data available for this crispr