ID: 1050245615

View in Genome Browser
Species Human (GRCh38)
Location 9:3686657-3686679
Sequence CGGGTTGCTAAAGACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050245611_1050245615 23 Left 1050245611 9:3686611-3686633 CCATCATATCAATGTTTTAAAGA No data
Right 1050245615 9:3686657-3686679 CGGGTTGCTAAAGACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050245615 Original CRISPR CGGGTTGCTAAAGACTTTGG TGG Intergenic
No off target data available for this crispr