ID: 1050248062

View in Genome Browser
Species Human (GRCh38)
Location 9:3713005-3713027
Sequence TGGAAGAGTGCAGTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050248050_1050248062 27 Left 1050248050 9:3712955-3712977 CCCCTGGCAGTGACCATGCTGCA No data
Right 1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG No data
1050248051_1050248062 26 Left 1050248051 9:3712956-3712978 CCCTGGCAGTGACCATGCTGCAA No data
Right 1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG No data
1050248052_1050248062 25 Left 1050248052 9:3712957-3712979 CCTGGCAGTGACCATGCTGCAAG No data
Right 1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG No data
1050248054_1050248062 14 Left 1050248054 9:3712968-3712990 CCATGCTGCAAGGAGAGAGAATC No data
Right 1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050248062 Original CRISPR TGGAAGAGTGCAGTGACTGG GGG Intergenic
No off target data available for this crispr