ID: 1050249847

View in Genome Browser
Species Human (GRCh38)
Location 9:3733341-3733363
Sequence TGGCACGGGTAGGATCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050249840_1050249847 26 Left 1050249840 9:3733292-3733314 CCCTGTTGAGCAAGTAAATAATG No data
Right 1050249847 9:3733341-3733363 TGGCACGGGTAGGATCTCATGGG No data
1050249841_1050249847 25 Left 1050249841 9:3733293-3733315 CCTGTTGAGCAAGTAAATAATGA No data
Right 1050249847 9:3733341-3733363 TGGCACGGGTAGGATCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050249847 Original CRISPR TGGCACGGGTAGGATCTCAT GGG Intergenic
No off target data available for this crispr