ID: 1050249894

View in Genome Browser
Species Human (GRCh38)
Location 9:3733728-3733750
Sequence CCAGCCCGCCGCTGCACTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050249886_1050249894 5 Left 1050249886 9:3733700-3733722 CCCACTCTGGCCCCGCTCGAGGA No data
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249884_1050249894 13 Left 1050249884 9:3733692-3733714 CCTTGGCGCCCACTCTGGCCCCG No data
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249887_1050249894 4 Left 1050249887 9:3733701-3733723 CCACTCTGGCCCCGCTCGAGGAG No data
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249889_1050249894 -6 Left 1050249889 9:3733711-3733733 CCCGCTCGAGGAGCCCTCCAGCC No data
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249888_1050249894 -5 Left 1050249888 9:3733710-3733732 CCCCGCTCGAGGAGCCCTCCAGC No data
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249881_1050249894 22 Left 1050249881 9:3733683-3733705 CCTCCTCGGCCTTGGCGCCCACT 0: 101
1: 189
2: 237
3: 969
4: 810
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249882_1050249894 19 Left 1050249882 9:3733686-3733708 CCTCGGCCTTGGCGCCCACTCTG 0: 93
1: 189
2: 216
3: 300
4: 1335
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data
1050249890_1050249894 -7 Left 1050249890 9:3733712-3733734 CCGCTCGAGGAGCCCTCCAGCCC No data
Right 1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050249894 Original CRISPR CCAGCCCGCCGCTGCACTGA CGG Intergenic
No off target data available for this crispr