ID: 1050250723

View in Genome Browser
Species Human (GRCh38)
Location 9:3741619-3741641
Sequence CGTGCTTCAGAATCCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050250722_1050250723 26 Left 1050250722 9:3741570-3741592 CCAAGATGACAGTTGACGACAGA No data
Right 1050250723 9:3741619-3741641 CGTGCTTCAGAATCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050250723 Original CRISPR CGTGCTTCAGAATCCTCTGC AGG Intergenic