ID: 1050260069

View in Genome Browser
Species Human (GRCh38)
Location 9:3831932-3831954
Sequence CCCAAAGACAACTATAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050260069 Original CRISPR CCCAAAGACAACTATAGATA TGG (reversed) Intronic
900820376 1:4882001-4882023 CCCAAGGAAAACTATAGAACAGG - Intergenic
906927299 1:50131936-50131958 CACACAGAAAACTATAGATTTGG + Intronic
907797693 1:57733842-57733864 CCCAAAGCCACCTAGAGATCAGG - Intronic
910812615 1:91253608-91253630 CCCAAAGGCAACAATGGCTAAGG - Intergenic
911371664 1:97002214-97002236 CCCAAAGACAATTACACATTTGG - Intergenic
912836086 1:112997709-112997731 GCCAATGACAACTAGAGATATGG + Intergenic
913176176 1:116275019-116275041 CCCAGAAATAACTATAAATAGGG + Intergenic
918335844 1:183511969-183511991 TACAAAGAGAACTAGAGATAGGG + Intronic
919362744 1:196615121-196615143 CCCAAAGACCACTAGGGAGAAGG + Intergenic
923657220 1:235927990-235928012 CCCAAAGCAATCTATAGATTCGG - Intergenic
924149176 1:241110487-241110509 CCTAAAGACAACCATTGATTTGG + Intronic
1063788553 10:9412833-9412855 CCCAAAGACAAGGAGAGAAATGG - Intergenic
1064857341 10:19784413-19784435 TCCAAAGAACACTAGAGATACGG + Intronic
1066531648 10:36347203-36347225 CCCAAAGAAAACTATATAGAAGG + Intergenic
1067724228 10:48755668-48755690 TCCAAAGACATATATAAATATGG - Intronic
1070534574 10:77365963-77365985 TCCAAAGACAATAATATATAAGG + Intronic
1071442509 10:85714817-85714839 CCCAAAGTGATCTATAGATTTGG + Intronic
1074589190 10:114796668-114796690 TTCAAAGACTTCTATAGATAAGG - Intergenic
1078816050 11:14823428-14823450 CCCAAAGGCAACAATGGTTAAGG - Intronic
1079191401 11:18280231-18280253 TCCAAAGACAATTATATAAATGG + Intronic
1079919953 11:26420646-26420668 CCTAGAGACAATTATAGCTAAGG - Intronic
1080810619 11:35700834-35700856 CCCAAAGATTACTAAAGTTATGG + Intronic
1085670861 11:78463689-78463711 AAAAAAGACAACTATAGTTAAGG + Intronic
1087244803 11:95822370-95822392 CATAATGCCAACTATAGATAAGG + Intronic
1087344929 11:96959935-96959957 CCCAAAGAAAAATTGAGATATGG + Intergenic
1088112252 11:106276082-106276104 CTCAAAGGCAACTAGAGAAAAGG - Intergenic
1088729685 11:112670227-112670249 CCCAAAGGCAACAACAGCTAAGG - Intergenic
1088824446 11:113482171-113482193 CTAAAAGAAAAATATAGATATGG + Intergenic
1090823464 11:130365946-130365968 CACAAACACAACAATAGATGTGG - Intergenic
1094062252 12:26326698-26326720 CCTAAAGACAAATAGAGATGTGG - Intergenic
1103298801 12:119910861-119910883 ACCAAAGTCAACGATAGGTAAGG + Intergenic
1108586233 13:51872366-51872388 CAAAAAGACAAACATAGATAGGG + Intergenic
1109081396 13:57906060-57906082 CACAAAGACAACCAAAGACATGG - Intergenic
1110252066 13:73391476-73391498 ACCAAAGAGAAATATAGATAAGG + Intergenic
1110668675 13:78149523-78149545 CCCCCAGACCACTAGAGATATGG - Intergenic
1111272708 13:85908108-85908130 GCCTAGGACAACTATAGAGAAGG - Intergenic
1111686668 13:91510593-91510615 CCCAAAGACAAATTAAAATATGG - Intronic
1112687201 13:101843501-101843523 CTCAAAGTCAACCATACATATGG - Intronic
1112997616 13:105593800-105593822 CCCAAAGGCAATTGGAGATAGGG + Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1114901905 14:27072024-27072046 CCAAAAGACAACTATCTAGAAGG - Intergenic
1115914584 14:38297745-38297767 TCCAAAGTCAACTATATACAGGG - Intergenic
1121811305 14:96893339-96893361 CCCAAAGACAACTTGATATCAGG - Intronic
1124587152 15:31020415-31020437 CAGAAAGACAACTGTACATACGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127672646 15:61210743-61210765 CTCAAAGACAACTAGACTTACGG + Intronic
1127894813 15:63287875-63287897 CACAATGACAATTATAGATTAGG - Intronic
1129174559 15:73830589-73830611 GCCAAAGGCAACTCTAGAGAAGG - Intergenic
1131197112 15:90364398-90364420 ACAAAAGAAAACTATAGAAAGGG - Intronic
1133554670 16:6894015-6894037 CCCAAAGACAGCTCTTTATATGG + Intronic
1133575488 16:7085085-7085107 CACACACACAACTTTAGATACGG - Intronic
1135622052 16:23964362-23964384 CGCAAAGGCAGCCATAGATAAGG - Intronic
1136251652 16:29009400-29009422 CCCAAAGACAACTCAGGATGTGG - Intergenic
1137849039 16:51720344-51720366 CCCAGTGACAACCATAGAGATGG - Intergenic
1141371624 16:83492074-83492096 CCCAAAGAGAACTATGTATTTGG + Intronic
1145715580 17:27017028-27017050 CCCAATGACAAGTATTGCTAAGG + Intergenic
1146740912 17:35282794-35282816 CACCATGACAACTAAAGATAGGG - Intergenic
1149483986 17:57027452-57027474 CCCAGAGAGAAGTACAGATAAGG + Intergenic
1154472382 18:14717044-14717066 CCCAATGACAAGTATTGCTAAGG - Intergenic
1155581867 18:27317905-27317927 CACAAAGACAAATTTAGCTAAGG - Intergenic
1159978134 18:74740947-74740969 CCCAGAGACAACTATAAAACTGG - Intronic
1163446826 19:17351849-17351871 GACAACGACACCTATAGATATGG - Exonic
1164052526 19:21595438-21595460 CCCAATGACCTCTGTAGATAGGG - Intergenic
1164115276 19:22213736-22213758 CCATAAGACAACCAGAGATATGG - Intergenic
1166251584 19:41575353-41575375 CCCAAAGATCTCTTTAGATATGG - Intronic
927896444 2:26785833-26785855 CCAATAGACAACTAAAGAGATGG - Intronic
935020473 2:99225679-99225701 CTTAAAGACAGCTAGAGATAAGG + Intronic
936015210 2:108953588-108953610 ACCAAAAACAACTATAGAACTGG - Intronic
936447241 2:112605935-112605957 CCCATAGAGAATTATAGAGATGG - Intergenic
936989291 2:118345546-118345568 CCAAAAGACAACAAACGATAAGG - Intergenic
939848605 2:147277648-147277670 CCTAAAGTCAAGTATTGATATGG - Intergenic
940192200 2:151053855-151053877 CCCAAATACAAAGATAGAAAGGG - Intergenic
941549336 2:166895407-166895429 CTCAAAAACAACTTTAGATCAGG - Intronic
942585376 2:177470023-177470045 CTCAAAGACCACTTTAGGTATGG - Intronic
943233252 2:185284911-185284933 CCCAGTGAAAACAATAGATAAGG - Intergenic
944306651 2:198187178-198187200 ACCAAAGACCACCATAGAGAAGG - Intronic
944319704 2:198325036-198325058 CTCAAAGACAACAAAAGGTAGGG + Intronic
944331983 2:198480119-198480141 CCAACAGAAAACTATATATAGGG + Intronic
945706090 2:213233852-213233874 GCTAAGGACAACCATAGATAAGG - Intergenic
946725192 2:222655382-222655404 GCCAAGAACAACTTTAGATAGGG - Intronic
1168959834 20:1861411-1861433 GCCAAAGACAACTTTAGAGGAGG - Intergenic
1169322774 20:4647871-4647893 ACCAATGACAACCATACATAAGG + Intergenic
1173566204 20:44040233-44040255 TCCATAGACACCTACAGATAGGG - Intronic
1176802109 21:13440855-13440877 CCCAATGACAAGTATTGCTAAGG + Intergenic
1184557905 22:45242957-45242979 CCCAAAGGCAACTACAGTTGCGG - Intergenic
1185019243 22:48364183-48364205 CCCAATGAAAACTCTAGACACGG + Intergenic
949926952 3:9049131-9049153 CCCCAAGTCAACTATAGAGGAGG + Intronic
949960917 3:9311569-9311591 CCCAAATACAACTGTATTTATGG + Intronic
950144414 3:10638530-10638552 CCCAAAGACAACAGGAAATAGGG + Intronic
957526385 3:81383843-81383865 CACAAAGAAAACTATAGTTCAGG + Intergenic
959297097 3:104549955-104549977 CACAAAGAAAACAATAGATTTGG + Intergenic
959472605 3:106771004-106771026 ACCAAAGACAACTTGAGATCAGG - Intergenic
963887275 3:150596813-150596835 CCTAAAGAGAATTATAGACAAGG - Intronic
964512816 3:157471682-157471704 CCTAAAGAAAAATATATATAAGG - Intronic
964525921 3:157615259-157615281 ACCAAAGACATCTATTGATTAGG - Intronic
968010981 3:195275330-195275352 CCAAATGACATCTACAGATATGG - Exonic
970211890 4:13718336-13718358 GCCAAAGGCAACTATAGAGTTGG - Intergenic
971031488 4:22642174-22642196 CCCAAAGATAACTATAGATGGGG + Intergenic
971786332 4:31108054-31108076 TCCAAAGAAAACTACAGAAAAGG + Intronic
972878883 4:43399113-43399135 GCCAAAGAAAACAAAAGATACGG + Intergenic
973886949 4:55332025-55332047 ATCAAAGACAAATATAAATAGGG + Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
976116377 4:81732647-81732669 ACCAAAGAGAACTCCAGATATGG - Intronic
978408414 4:108403958-108403980 CCCAAAGACAACTATCCCAAAGG - Intergenic
978727255 4:111984021-111984043 CCTAAAGAGAAATAGAGATAAGG - Intergenic
981575846 4:146204446-146204468 CCCAAAGACAAGGAGAGAGATGG - Intergenic
987937934 5:24492430-24492452 ACCAAAGCCAAATATACATAAGG - Intronic
988537957 5:32085911-32085933 CCCAAAGTCATCTATAGATTCGG - Intronic
989348441 5:40455672-40455694 CCCAGAGACAAATGTAGAGATGG + Intergenic
990949384 5:61281661-61281683 TCAAAAGACAAATATAGATTCGG + Intergenic
991334000 5:65526406-65526428 CCTATAGACAATTATAAATAAGG + Intronic
991433714 5:66574381-66574403 CATAAAGATAACTTTAGATATGG + Intergenic
992425516 5:76652899-76652921 CTGAAAGACAGCTATAGAAAGGG + Intronic
995618055 5:113989279-113989301 CCCAAAACCAAATAGAGATATGG - Intergenic
997061386 5:130507642-130507664 CCCAAAGTGATCTATAGATTTGG - Intergenic
997851734 5:137339185-137339207 CCCAAAGGAACCTATAGAAAGGG - Intronic
998617750 5:143759420-143759442 CACACACACAACAATAGATAAGG - Intergenic
999591784 5:153156243-153156265 CTGAAAGCCAACTATACATAAGG - Intergenic
1004385534 6:15169526-15169548 CCCAAAGCCAACTAGAAGTAAGG - Intergenic
1006180555 6:32151206-32151228 CCCAAAGGCAGCTATAGCAAAGG - Intronic
1009355088 6:62733678-62733700 CCAAGAGACAACTATATATATGG - Intergenic
1012035858 6:94138153-94138175 CCCATACACATCTTTAGATATGG - Intergenic
1014540009 6:122663860-122663882 CCCCAAAACAAATACAGATATGG - Intronic
1016012127 6:139148221-139148243 AGCAAAGACAACCATAAATAAGG - Intronic
1016262958 6:142195752-142195774 CACAAAGAAAACTATAATTATGG - Intronic
1017778019 6:157694780-157694802 ACAGAAGACAACTATAGACATGG + Intergenic
1017994561 6:159520947-159520969 CCCAAAGGCAACAACAGCTAAGG + Intergenic
1021760606 7:23899993-23900015 CCCAATGTCAATTCTAGATATGG - Intergenic
1027926966 7:84477666-84477688 CCCCAACACCTCTATAGATATGG - Intronic
1031345082 7:120655059-120655081 CACCAAGACAATTATAAATATGG - Intronic
1031827291 7:126581928-126581950 CCCAAAGAGAGGTATAGAGATGG - Intronic
1031851187 7:126866209-126866231 TCCAAAGAAAAGTATAGAAATGG - Intronic
1032161211 7:129512222-129512244 TTCAAAGACAAATATAAATATGG - Intronic
1032917862 7:136511724-136511746 CCCAGAGACACCTATAGAAGGGG - Intergenic
1035550329 8:518428-518450 CACTAAGACAACTGTAGAAATGG + Intronic
1037110408 8:15158744-15158766 CCCAAAGACAATTTTGGAGATGG + Intronic
1045085806 8:98683615-98683637 CCATAAGAAAATTATAGATAAGG + Intronic
1047041653 8:121003712-121003734 CTCAAAGCCTACTATAGATAGGG + Intergenic
1048713029 8:137233295-137233317 CAGAAAGACAGTTATAGATATGG + Intergenic
1049907116 9:228256-228278 CCCAAAAAAAACTTTACATATGG + Intronic
1050260069 9:3831932-3831954 CCCAAAGACAACTATAGATATGG - Intronic
1051725962 9:20088610-20088632 CCCAAAGACAACAACAGCTAAGG - Intergenic
1052019782 9:23512332-23512354 CCAAAAAAAATCTATAGATATGG - Intergenic
1056601399 9:88049961-88049983 CCCAAACACAGCCATAGATGGGG - Intergenic
1186185782 X:7018342-7018364 AGCAAACACAACTATAAATAAGG + Intergenic
1189209263 X:39269683-39269705 GCTAAAGACAACTAGAGAGAGGG + Intergenic
1189614945 X:42773643-42773665 CCCAAAGAAAGCTGAAGATATGG + Intergenic
1189674147 X:43443828-43443850 CCCAAAGGCAACAATGGCTAAGG + Intergenic
1194443910 X:93964476-93964498 CTTAAAGACAGCTATAGAAAAGG - Intergenic
1198434536 X:136603318-136603340 CACACAGACACCTATAAATACGG + Intergenic
1200596825 Y:5152466-5152488 TCCTAAGACATCTATATATACGG - Intronic
1200894169 Y:8356976-8356998 CACCAAGACCACTATAGAAAGGG + Intergenic
1200904326 Y:8466001-8466023 CACCAAGCCCACTATAGATAGGG - Intergenic
1202253221 Y:22894123-22894145 CCCCAAGCCCACTATAGAAAGGG + Intergenic
1202406211 Y:24527872-24527894 CCCCAAGCCCACTATAGAAAGGG + Intergenic
1202464571 Y:25142209-25142231 CCCCAAGCCCACTATAGAAAGGG - Intergenic