ID: 1050272068

View in Genome Browser
Species Human (GRCh38)
Location 9:3956978-3957000
Sequence CCATCCTTGAGAACTTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050272066_1050272068 -1 Left 1050272066 9:3956956-3956978 CCTGGCAAATCGTCTAAGAGCTC No data
Right 1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG No data
1050272063_1050272068 10 Left 1050272063 9:3956945-3956967 CCCATATCTTCCCTGGCAAATCG No data
Right 1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG No data
1050272065_1050272068 0 Left 1050272065 9:3956955-3956977 CCCTGGCAAATCGTCTAAGAGCT No data
Right 1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG No data
1050272064_1050272068 9 Left 1050272064 9:3956946-3956968 CCATATCTTCCCTGGCAAATCGT No data
Right 1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG No data
1050272062_1050272068 11 Left 1050272062 9:3956944-3956966 CCCCATATCTTCCCTGGCAAATC No data
Right 1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG No data
1050272061_1050272068 12 Left 1050272061 9:3956943-3956965 CCCCCATATCTTCCCTGGCAAAT No data
Right 1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050272068 Original CRISPR CCATCCTTGAGAACTTGCCC TGG Intronic