ID: 1050274030

View in Genome Browser
Species Human (GRCh38)
Location 9:3977824-3977846
Sequence GTCATCACCATTTCTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050274027_1050274030 29 Left 1050274027 9:3977772-3977794 CCAAAGAGGAGAAAAAAATATTC 0: 1
1: 1
2: 6
3: 100
4: 950
Right 1050274030 9:3977824-3977846 GTCATCACCATTTCTACAGCAGG No data
1050274029_1050274030 -8 Left 1050274029 9:3977809-3977831 CCAGGAACACTAGCAGTCATCAC 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1050274030 9:3977824-3977846 GTCATCACCATTTCTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050274030 Original CRISPR GTCATCACCATTTCTACAGC AGG Intronic
No off target data available for this crispr