ID: 1050275398

View in Genome Browser
Species Human (GRCh38)
Location 9:3992453-3992475
Sequence CTGTTTATGCATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050275398_1050275405 27 Left 1050275398 9:3992453-3992475 CCTTCCTCCTCATGCATAAACAG 0: 1
1: 0
2: 0
3: 12
4: 247
Right 1050275405 9:3992503-3992525 CCTCAGCGTAAAGGAGGAGATGG No data
1050275398_1050275402 18 Left 1050275398 9:3992453-3992475 CCTTCCTCCTCATGCATAAACAG 0: 1
1: 0
2: 0
3: 12
4: 247
Right 1050275402 9:3992494-3992516 AAAGCAAATCCTCAGCGTAAAGG No data
1050275398_1050275401 -9 Left 1050275398 9:3992453-3992475 CCTTCCTCCTCATGCATAAACAG 0: 1
1: 0
2: 0
3: 12
4: 247
Right 1050275401 9:3992467-3992489 CATAAACAGTGAATGCACACAGG No data
1050275398_1050275403 21 Left 1050275398 9:3992453-3992475 CCTTCCTCCTCATGCATAAACAG 0: 1
1: 0
2: 0
3: 12
4: 247
Right 1050275403 9:3992497-3992519 GCAAATCCTCAGCGTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050275398 Original CRISPR CTGTTTATGCATGAGGAGGA AGG (reversed) Intronic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
900767275 1:4513774-4513796 CTGTTCATGCCTGATGATGAGGG + Intergenic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
902984397 1:20146771-20146793 CTGTTCAAACATGAGGTGGAGGG + Intronic
904882260 1:33709870-33709892 CTGTGGATTCACGAGGAGGAGGG + Intronic
905624440 1:39478315-39478337 TTGTTGAGGCTTGAGGAGGAAGG + Intronic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
908753490 1:67446445-67446467 CTATTTATGCATGCACAGGATGG - Intergenic
911942419 1:104064390-104064412 CTATTTATGCAAAAGGAAGAGGG + Intergenic
913221490 1:116664273-116664295 CTGTTTACACATGAAGATGAGGG + Intronic
914348511 1:146820083-146820105 CTGTCTTTGAATGTGGAGGAAGG - Intergenic
914402391 1:147334863-147334885 GTGTCAATGCATGAGGAGAATGG + Intergenic
914915003 1:151814274-151814296 TTGTTGATGGAAGAGGAGGAAGG + Intronic
916299799 1:163261319-163261341 GTCTTTATGTATGAGCAGGAAGG - Intronic
917201616 1:172522833-172522855 CTGTCTATGCATGAGAAAGTGGG + Intergenic
917908417 1:179613609-179613631 CTATCTATGAATGAGGAAGAAGG - Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918297878 1:183174618-183174640 CTGCTGATGGCTGAGGAGGAGGG + Intergenic
918532169 1:185535522-185535544 CATTTTATGCATGGAGAGGAAGG + Intergenic
922746417 1:228046923-228046945 CTGTGCATGCATGTGGTGGAAGG + Intronic
922775082 1:228210881-228210903 CTCTTTATCCATGAGCGGGAAGG - Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1072786889 10:98289825-98289847 CTGACTATGCATGACCAGGAGGG + Intergenic
1074165068 10:110867799-110867821 CTGCTTAAGCCTGAGGAGTACGG + Intergenic
1074845241 10:117391846-117391868 CTGTTTATACAGGAACAGGATGG + Intergenic
1076728168 10:132423036-132423058 CTGCTTAGGCCTGGGGAGGAGGG - Intergenic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1080516583 11:33027509-33027531 ATGTTTATGCTTGAGAAAGAAGG + Intronic
1081267433 11:41043085-41043107 TTTTTTTTGCATGACGAGGAAGG + Intronic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1085922140 11:80970122-80970144 GTGTCTGTGCATGAGGAGCAAGG - Intergenic
1087648972 11:100842237-100842259 CAGTTTATGCATGTAGACGATGG - Intronic
1088093669 11:106074133-106074155 CTCTTAATGTATGAGAAGGAAGG - Intronic
1090971700 11:131649351-131649373 CTGTTTATGCATATCGGGGAGGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1093465253 12:19441719-19441741 CTGTGTAGGCATGGGTAGGAAGG + Intronic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1094131452 12:27079807-27079829 CTGTGGTTGAATGAGGAGGATGG + Intergenic
1094180861 12:27591310-27591332 CTGTGATTGAATGAGGAGGATGG + Intronic
1097642338 12:62197296-62197318 CTGCTTAGACTTGAGGAGGATGG - Intronic
1098753623 12:74328530-74328552 ATGTGTATGCATGAAGAAGAAGG - Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1101569168 12:105937215-105937237 ATGTTTGTGCATGAGGTGGGAGG - Intergenic
1104622892 12:130331624-130331646 GTGCGTATGCATGAGGAGGCGGG + Intergenic
1106868652 13:33995260-33995282 CTGTTTATATATCAGCAGGATGG + Intergenic
1107259933 13:38477971-38477993 ATGTTTATACATGAGGGTGAAGG - Intergenic
1107743385 13:43479081-43479103 ATCTTTATGCATGCGGAGTATGG - Intronic
1108521632 13:51251680-51251702 CTGTTCCTGCAGGAGGAGTACGG + Exonic
1109278815 13:60331807-60331829 CCCATTATGCCTGAGGAGGAGGG + Intergenic
1110583896 13:77164944-77164966 CTTTTAATACATGAAGAGGATGG - Intronic
1111911493 13:94317221-94317243 TTATTTATGCATGATGAGGCAGG + Intronic
1112119112 13:96390446-96390468 CTTTTTATGAATGAGGAAGCAGG + Intronic
1113352173 13:109540099-109540121 CTCATTAGGCATGAGGATGAAGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1116536294 14:46035276-46035298 CTGTTTATAAATGAGGAGACAGG - Intergenic
1116537570 14:46053438-46053460 CTTTTTATGGATGCTGAGGAAGG + Intergenic
1117714420 14:58566083-58566105 TTGTTCATGCAGGAGGGGGAAGG + Intergenic
1119223882 14:72929311-72929333 AGGTTCATGCATGAGGAGGTCGG - Intronic
1119231024 14:72979923-72979945 CTGTTTTTGCATTATCAGGATGG - Intronic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1122031665 14:98916691-98916713 CGGTCTATGTAAGAGGAGGAGGG - Intergenic
1122036822 14:98954990-98955012 CTGTCTTTTCTTGAGGAGGAGGG - Intergenic
1122295575 14:100703895-100703917 CAGTTTATGGATGAGGAGTCTGG + Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1125145989 15:36468983-36469005 CTGTTTATGTATGTGGGAGAAGG - Intergenic
1128904110 15:71452119-71452141 GTGGTTAGGCATGAGGTGGATGG - Intronic
1130542315 15:84829547-84829569 ATGATTATTCATGAGGAGGTAGG + Intronic
1131418314 15:92280248-92280270 CTGATTCTCCATGTGGAGGAAGG - Intergenic
1132366913 15:101264475-101264497 CTGTTTCTGCAGGAGGAAGCAGG - Intergenic
1133611814 16:7440707-7440729 CTGTTTAGGGCTGGGGAGGAGGG + Intronic
1133658691 16:7892800-7892822 CTATATTTGCATGATGAGGATGG + Intergenic
1134849048 16:17465668-17465690 CTGTTTCTGTGTGAGCAGGACGG - Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1138689769 16:58756433-58756455 CTGTTGTTGCATGGGGAGGACGG + Intergenic
1141100972 16:81197337-81197359 ATGTTTAAGCATGTGGAGGTGGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141636864 16:85318559-85318581 CATTTTATGGATGAGGAGGCTGG - Intergenic
1144331519 17:14228418-14228440 ATGTTCATGCCTGAAGAGGATGG + Intergenic
1144658981 17:17056222-17056244 CTGTTTCTGAATGGGAAGGACGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1151166112 17:72205303-72205325 CTGTGGATGGATGAGGAGGGCGG - Intergenic
1151246133 17:72796380-72796402 CTCTATATGCATGAGAAGGAGGG + Intronic
1153320161 18:3765043-3765065 CTGTTTATGTAGGTGGTGGATGG + Intronic
1157132385 18:45018903-45018925 CTGATTAGGAATGAGCAGGAAGG + Intronic
1158265611 18:55657856-55657878 CAGTTTATGCAAAAGCAGGAGGG + Intronic
1158331900 18:56371593-56371615 CTGTTTCTCCTTGAGGAGGGAGG - Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159770188 18:72539764-72539786 GCATTTATGGATGAGGAGGATGG - Intronic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1163215266 19:15871705-15871727 CTGATCATGCATGCGGAGGGCGG - Intergenic
1165231800 19:34391975-34391997 CTGTTCATGTCTGAGGAGGTAGG + Intronic
1165231815 19:34392075-34392097 CTGTTAATGTCTGAGGAGGTAGG + Intronic
1166519320 19:43469606-43469628 CATTTTATGGATGAGGATGAGGG - Intergenic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167552008 19:50167817-50167839 CCGTGTGTGCATGTGGAGGAAGG - Intergenic
1168537363 19:57182182-57182204 ATGATTATTCATGAGGAGGTGGG - Intergenic
927248593 2:20978353-20978375 CTGTTTCTGCAGGAGAATGAGGG - Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931052215 2:58428076-58428098 CAGTTTCTGGAAGAGGAGGAGGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
933188450 2:79304915-79304937 CAGTTTATGCATAAGGATGGCGG - Intronic
934898987 2:98142108-98142130 GTGTTTATGCATCAGGAGGTGGG + Intronic
934948326 2:98558267-98558289 GAGCTTATGAATGAGGAGGAAGG - Intronic
935668454 2:105534970-105534992 CTGATTATGGATGAGGTGGAGGG - Intergenic
936417687 2:112332311-112332333 CTGTTAATGCCTGAACAGGAAGG - Exonic
938835453 2:135098567-135098589 CTGTTTATGGATGCTGGGGATGG + Intronic
939372453 2:141318962-141318984 CTGTTTTTGCATTATGAAGAAGG - Intronic
940799233 2:158115146-158115168 CTGTTTATGCACAAGGAGCTCGG + Exonic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942832238 2:180250911-180250933 CTGTGCATGAATGAGCAGGAAGG + Intergenic
943314249 2:186366365-186366387 CTTTTTATTTTTGAGGAGGAGGG - Intergenic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
947319542 2:228900766-228900788 CTGTTTGTGAATGGGCAGGAGGG + Intronic
1169200216 20:3705632-3705654 CTGGTTTTGCATCAGGAGCAAGG + Intronic
1170108657 20:12780647-12780669 CTGTTCCTGCATAAGGATGATGG + Intergenic
1170955044 20:20972264-20972286 CCCTTGATGGATGAGGAGGAAGG + Intergenic
1171378127 20:24709148-24709170 CTGTTTCTGCAAGAGGCAGATGG - Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1173421774 20:42907691-42907713 CTGTTGATGCAAGAGGCTGAAGG - Intronic
1174507675 20:51027208-51027230 CTGGTTATGGATGGGAAGGAAGG - Intergenic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1182019165 22:27066431-27066453 CTGTTCATGGTTTAGGAGGAAGG + Intergenic
1182915185 22:34022881-34022903 ATGTTTATGGATGATGATGATGG - Intergenic
1183066780 22:35368826-35368848 CTGTTTTTGCAAGTGGATGAAGG + Intergenic
1183936516 22:41265526-41265548 CTGTTCGTGCAGGAGGAGGGAGG + Intronic
951759866 3:26135380-26135402 CTGCTCTTGCATGAGGAGGCAGG + Intergenic
951933165 3:27992849-27992871 CAGTTTGTGTATGGGGAGGAGGG - Intergenic
953136291 3:40185153-40185175 GTGTTTATGCCTCAGGAGAAGGG + Intronic
954127409 3:48539601-48539623 CTGCTTATGCATGAGGGGCATGG - Intronic
956019762 3:64921680-64921702 CTTTTTGTGGATGGGGAGGACGG + Intergenic
959888784 3:111531294-111531316 TTGTTTAGGCATTGGGAGGATGG + Intronic
964738973 3:159945619-159945641 GTGTGTATGCATGAGTGGGAGGG - Intergenic
965379981 3:167976432-167976454 ATTTTTATGCATAAGGAGAAAGG + Intergenic
965668023 3:171116946-171116968 CTACATATGCATGAGAAGGAAGG + Intronic
966570902 3:181441779-181441801 CTGCTGCTGAATGAGGAGGAGGG + Intergenic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
970462796 4:16292409-16292431 CTGTTTATCAATGAGGAAGTGGG + Intergenic
971112603 4:23605842-23605864 CTGTCTATGCATCAGGAAGTGGG - Intergenic
971942467 4:33233511-33233533 CTGTTAAAGCCTGAAGAGGAAGG + Intergenic
972631603 4:40846804-40846826 CTGCTTACTAATGAGGAGGAGGG + Intronic
974468520 4:62289494-62289516 ATGTTTTTGGATGAAGAGGATGG + Intergenic
975420705 4:74160553-74160575 CTGTTTATGCATGAGAATTTAGG + Intronic
977899923 4:102408457-102408479 GTGTTTTGGCATGAGGAGGGAGG - Intronic
977899967 4:102411091-102411113 GTGTTTTGGCATGAGGAGGGAGG - Intronic
978281462 4:107020870-107020892 CTGTTTCTGAAAGAGGAGGCAGG - Intronic
979328165 4:119403115-119403137 ATGGTCATCCATGAGGAGGAGGG + Intergenic
980171849 4:129298734-129298756 CTGTTGGAGCATGAGGAAGATGG + Intergenic
981744704 4:148041196-148041218 ATGTTTAAGAATGAGGAGCATGG + Intronic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
982348115 4:154384334-154384356 CAGGTGGTGCATGAGGAGGAGGG - Intronic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
982816159 4:159887489-159887511 CTTTTTATTCAAGATGAGGAGGG - Intergenic
982931592 4:161414970-161414992 CTGGTTATGCATTAGTAGAAAGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
988100472 5:26669864-26669886 CTGCTGCCGCATGAGGAGGAAGG + Intergenic
989469216 5:41795439-41795461 CTACTTAGGAATGAGGAGGAAGG + Intronic
993760639 5:91792562-91792584 ATGTTTATGTATGAGGAGAAGGG - Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994380600 5:99066545-99066567 CTGTTGATTCATCTGGAGGATGG - Intergenic
997860116 5:137408514-137408536 CTTTTTATCCCTGAGAAGGAGGG - Intronic
998402965 5:141857557-141857579 CTGTTGAAGCCTGAGTAGGATGG - Intronic
998870376 5:146545649-146545671 CTGCTAATGCATGGGGATGAGGG - Intergenic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
1000383087 5:160646610-160646632 CTGTTTATTAAGGAGGAGGCTGG + Intronic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002683708 5:180990265-180990287 CTGTTTCTGCATGAGGCAGCAGG + Intronic
1003392860 6:5728433-5728455 CTGTTTATTCATGACAGGGAGGG + Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004007450 6:11650211-11650233 TTATTTATGCATGAGTAGCACGG + Intergenic
1004400075 6:15280410-15280432 TTTTTAATGCAGGAGGAGGAAGG - Intronic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1005394521 6:25367572-25367594 CTGTTAAGGCTTGAAGAGGAAGG + Intronic
1005808583 6:29498763-29498785 CTGTGTATGCTTGAGAAGAATGG + Intergenic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1008367610 6:50700775-50700797 CTGTGTATGCATGGTCAGGATGG + Intergenic
1009934711 6:70220234-70220256 CAGTTTATGCATGAGAAAAATGG - Intronic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1012619679 6:101327056-101327078 TTGTTTCAGCATGAGGAGAATGG + Intergenic
1013358685 6:109372566-109372588 CTGTTTAATCAAGAGCAGGATGG - Intronic
1014078643 6:117265098-117265120 CTGATGATGTATGGGGAGGACGG - Intergenic
1014545640 6:122732354-122732376 CTGTTTTTCCAAGAGCAGGAAGG + Intergenic
1015709850 6:136127992-136128014 CTGTTTAAGAATGAGGAGTGAGG - Intronic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019703204 7:2484451-2484473 ATGTTTATGGATGAGGAGTAAGG - Intergenic
1022202665 7:28132660-28132682 ATGTTTATGCATGTGGATGCAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023401930 7:39797114-39797136 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1024075907 7:45817744-45817766 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1024647691 7:51383548-51383570 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1024855520 7:53773871-53773893 GTGTTCATGCCTGTGGAGGAAGG - Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1025051527 7:55738040-55738062 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025128490 7:56363707-56363729 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025176872 7:56806585-56806607 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025694921 7:63769801-63769823 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1030064850 7:105651784-105651806 ATGTTTGTGCATGAGGAGGCTGG - Intronic
1031024451 7:116664839-116664861 CTGTATTTGCAAGGGGAGGAAGG - Intergenic
1033801503 7:144907497-144907519 TGGATTATGCATGTGGAGGAAGG - Intergenic
1034396466 7:150829331-150829353 CTGATTATTCATGAGGGGGTGGG + Intronic
1034492468 7:151401075-151401097 CTGATTATTCATGAGCAGGTGGG - Intronic
1035814384 8:2523444-2523466 CTGTTAATTCATGAAGAAGAGGG - Intergenic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040880392 8:52198872-52198894 CTGGTGTTGCATGTGGAGGAAGG - Intronic
1042007425 8:64197175-64197197 CTTGTTATGTATGAGGAAGAGGG + Intergenic
1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG + Intergenic
1043930744 8:86088509-86088531 CTGTTTAGGAAAGAGGAGAAGGG + Intronic
1044121137 8:88397587-88397609 CTGTTGATGTGTGAGGTGGAAGG - Intergenic
1045062698 8:98423096-98423118 TTCTTGATGCATCAGGAGGAAGG + Intronic
1046799999 8:118415710-118415732 CTGTTTATCCTAGAGGAGAATGG - Intronic
1047428148 8:124765667-124765689 CTGGTTTTGCATTAGGAGAATGG - Intergenic
1047676271 8:127206513-127206535 CTATTTATGAAAGAGGCGGATGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1053412442 9:37924471-37924493 ATATTTATGCAGGAGAAGGATGG + Intronic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054798267 9:69323032-69323054 CTGTTTCTGCATGGGGAAAAAGG + Intergenic
1056487601 9:87074798-87074820 CTGTGTATGCGTGAGTAGCATGG + Intergenic
1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG + Intronic
1056945062 9:90987683-90987705 CTGTTTCTGCAGGTAGAGGAGGG - Intergenic
1057008266 9:91580213-91580235 CTCGTTATGCATTAGGTGGAAGG + Intronic
1060398083 9:123330285-123330307 CTCTCTGTGCATGAAGAGGAGGG - Intergenic
1062610573 9:137371632-137371654 CTGATCATGTATGAGGAGGCCGG - Intronic
1185975057 X:4710897-4710919 CCGTGTGTGCATTAGGAGGATGG + Intergenic
1187809717 X:23162051-23162073 CTATGTATGCATGAGGCGTAGGG - Intergenic
1188580314 X:31703593-31703615 CAGTTTAGGCATGGGTAGGAAGG - Intronic
1189234235 X:39475458-39475480 CTGTTTAAACAAGAGTAGGAGGG - Intergenic
1189798389 X:44668513-44668535 GTGTTTGTGCATGTAGAGGATGG - Intergenic
1190378983 X:49819712-49819734 CTGATTATGCAAGAGAAGGGAGG - Intergenic
1190640585 X:52480628-52480650 CTGTTTATTCATTGGAAGGAAGG + Intergenic
1190647087 X:52532237-52532259 CTGTTTATTCATTGGAAGGAAGG - Intergenic
1190874458 X:54449728-54449750 CTGTTCATGCTTCAGGAGGGTGG + Exonic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1194467887 X:94255682-94255704 GTGTTTATGCAGGGGCAGGATGG - Intergenic
1195652605 X:107300846-107300868 CTGTTAAAACATGAGGTGGAGGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic