ID: 1050282524

View in Genome Browser
Species Human (GRCh38)
Location 9:4066004-4066026
Sequence CATTTTAATGAGATGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050282524_1050282528 13 Left 1050282524 9:4066004-4066026 CCTTCCAACATCTCATTAAAATG 0: 1
1: 1
2: 2
3: 26
4: 316
Right 1050282528 9:4066040-4066062 AAAAAAAAAAAAAAAGAAACAGG 0: 97
1: 2846
2: 41977
3: 62842
4: 117878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050282524 Original CRISPR CATTTTAATGAGATGTTGGA AGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
903248232 1:22032661-22032683 CATTTTAATGGAATTCTGGAAGG + Intergenic
903551997 1:24163874-24163896 CATTTGAAAGAGATGTGGGTTGG - Intronic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
907587101 1:55629709-55629731 CATTTTGATGAGATCTCAGATGG - Intergenic
908094901 1:60727605-60727627 AATTTCAATGTGAGGTTGGAGGG - Intergenic
908186822 1:61660443-61660465 CATTTTAATTAGTTCTGGGATGG - Intergenic
908334960 1:63112570-63112592 CTTTTTAATGTGATGCTGCATGG - Intergenic
908652767 1:66353957-66353979 CATATTAATGAGCTGATGGAGGG + Intronic
909680607 1:78287399-78287421 TATTTTCATGAAATGTTTGAGGG + Intergenic
910078506 1:83310085-83310107 TCTTTTAATGTGTTGTTGGATGG - Intergenic
910969588 1:92842373-92842395 AATTTTATGGAGATGTTGAAAGG + Exonic
911475682 1:98369255-98369277 CATTTTAATGAGATGTGGCTAGG - Intergenic
911552187 1:99296522-99296544 CACTCTAATGAGATTTTGTAGGG - Intronic
911714533 1:101115801-101115823 CATTGTAAAGAGATGTTAGCTGG - Intergenic
911838631 1:102653565-102653587 GATTTTAATAAGCTCTTGGAAGG - Intergenic
916660015 1:166914862-166914884 CATTTAAATCTGATTTTGGAAGG + Exonic
916803499 1:168236286-168236308 CATTTGAATGAAAAGATGGATGG + Intronic
917179820 1:172283814-172283836 GATTTTATTGAGATGTAAGAGGG + Intronic
918373563 1:183885473-183885495 CATATTAATCTGAAGTTGGAGGG + Intronic
918900596 1:190411672-190411694 CATTTTAGTGAAATGTTAGGAGG - Intronic
918985054 1:191614461-191614483 CAATTAAATGAGATGTTGTTTGG + Intergenic
919193434 1:194253053-194253075 TATGCTAATGAGATGATGGAAGG + Intergenic
920144332 1:203845257-203845279 CATTTCAATGAAATTTTGGTAGG + Intronic
921031375 1:211337811-211337833 CATTTCACTGAGATGGAGGAAGG + Intronic
921211023 1:212897859-212897881 CATTTCAATGTGAGATTGGAGGG + Exonic
921565999 1:216720966-216720988 CATTTTAATCAGAGGTTGAAAGG + Intronic
923430121 1:233911897-233911919 CTTTTTAATGAGATCCAGGAGGG - Intronic
923488083 1:234455562-234455584 CATTTTAATGAAAACTTGCAAGG + Intronic
923616339 1:235541250-235541272 AAAATTAATGAGAGGTTGGATGG + Intergenic
923849060 1:237772921-237772943 CATTTTAAAGATATTTTGGTTGG - Intronic
924292564 1:242552606-242552628 CATTGTAATAAGATATTGGGAGG + Intergenic
1063083916 10:2796987-2797009 CATTTTATTGAGATTTTGATAGG - Intergenic
1063523673 10:6763504-6763526 CATTTTAATAAAAGGTAGGAGGG + Intergenic
1064291756 10:14040846-14040868 CCATTTAATGAGGTGTTGAAGGG + Intronic
1065691101 10:28334816-28334838 CATTTCAATAGGATTTTGGAAGG - Intergenic
1066533507 10:36365828-36365850 CATTCTAATGAGGTCTTGGATGG + Intergenic
1068338270 10:55667056-55667078 CATATTATTTAGATGTTGGGAGG - Intergenic
1068688638 10:59894130-59894152 CTTTTTAATGAAATATTTGAAGG - Intronic
1068886054 10:62098178-62098200 CATTTCAATGGGGTGATGGAAGG + Intergenic
1069217436 10:65839559-65839581 CATAATGATGAGATGTTTGAGGG - Intergenic
1069494936 10:68895124-68895146 CCCTTTACTGATATGTTGGAGGG + Intronic
1071010107 10:80928632-80928654 CATTTTGAGTATATGTTGGATGG - Intergenic
1071836885 10:89427076-89427098 CATTTTTAAGAGATGGTGAAAGG - Intergenic
1072344767 10:94493482-94493504 GATTTTAATAAGAAGATGGATGG + Intronic
1072889177 10:99306574-99306596 CATATGAATGAAATGTTGGGTGG + Intergenic
1073511261 10:104043987-104044009 CATTTTAATGAACTGAAGGAAGG + Intronic
1074255768 10:111801121-111801143 CATTTTAATTATATTTTGAAAGG - Intergenic
1074969966 10:118528050-118528072 CATGTTTATGAGATGGTGGCCGG - Intergenic
1075763784 10:124877007-124877029 CATTTTAAGGAGAGGTTGCTAGG + Intergenic
1075859376 10:125661587-125661609 CATGTTAATGAGCTGTGGGCTGG + Intronic
1077655230 11:4012605-4012627 CAGTTTAAGGAGATTTTGGGCGG + Intronic
1078400506 11:11022341-11022363 CATTTTGCTGTGATGTTGGGTGG - Intergenic
1078914347 11:15764645-15764667 CATTTTAGTGAAATTTAGGAAGG - Intergenic
1080309850 11:30877234-30877256 CACTTTAATGTGATGCAGGAAGG - Intronic
1081048410 11:38306313-38306335 CATTTAAATTATATTTTGGAAGG - Intergenic
1082897899 11:58212597-58212619 GATTTTATTAAGATCTTGGAAGG + Intergenic
1083340893 11:61957678-61957700 CATATTAAAGAGAGGTTGGCCGG + Intronic
1083667271 11:64282567-64282589 CATTTTCATGAGATGAGGGCAGG - Intronic
1085358994 11:75868457-75868479 CATGAGAATGAGATTTTGGAAGG + Intronic
1087911950 11:103764018-103764040 CATTTTAGTGAGATTTTAGAGGG + Intergenic
1088597215 11:111449534-111449556 CATTTGAATGGGAGGGTGGAGGG - Intronic
1089929955 11:122299867-122299889 CATTTTAATGTGAGGTTTGGAGG + Intergenic
1090546374 11:127771849-127771871 GATTTTAATGAGATGGTAAAGGG + Intergenic
1091163932 11:133453900-133453922 GATATTAATGAGATATTTGAAGG + Intronic
1092090609 12:5800671-5800693 CCTTTTACTGAAATGTGGGAAGG + Intronic
1092556144 12:9563979-9564001 TATTTTAATGATATTTTTGAAGG + Intergenic
1092892676 12:12983543-12983565 AATGTTAATGAGATGGTAGAAGG - Intronic
1093417381 12:18935288-18935310 CATTTCAATGAGATCTTTGGAGG - Intergenic
1093443307 12:19225622-19225644 CATTATAAGGTGATGTTAGAGGG + Intronic
1093679644 12:21987234-21987256 CATTAGAATGAGAGGTTAGATGG + Intergenic
1094515947 12:31126671-31126693 TATTTTAATGATATTTTTGAAGG - Intergenic
1095221515 12:39621463-39621485 AATTTTAATGAGATGGGGGGCGG - Intergenic
1095469039 12:42517251-42517273 CACTTTAATGAAATTTTGCAAGG + Intronic
1095905037 12:47368978-47369000 CACTTTAAAGACATGTTGTATGG + Intergenic
1096417897 12:51429472-51429494 CATTTTGATGAGATCTCTGAAGG + Intronic
1097629048 12:62036993-62037015 TATTTTAATGAGTGCTTGGAAGG + Intronic
1098183621 12:67874328-67874350 CATTTTAAGGGCATGTGGGATGG - Intergenic
1099074114 12:78083355-78083377 AATTTTAATGTGAATTTGGAGGG + Intronic
1100145415 12:91671656-91671678 CATTTTAATGAGGTTTTGGGAGG + Intergenic
1100215190 12:92440562-92440584 AATTTTAATGACATATTAGATGG + Intergenic
1100226857 12:92566433-92566455 CATTTTAATAGGCTTTTGGATGG - Intergenic
1102982461 12:117252962-117252984 CAGTTTAATGGGTTCTTGGAAGG - Intronic
1104345124 12:127989571-127989593 CATTTTTAAGACATGTTTGAAGG + Intergenic
1105631628 13:22175288-22175310 CATTTTAATTAGGTAATGGAAGG - Intergenic
1106533741 13:30619098-30619120 CATTTAAGTGAGATATGGGAAGG + Intronic
1107189297 13:37560413-37560435 CATTTTGATGAAATTTTGAATGG - Intergenic
1107312930 13:39099068-39099090 CATTCTAAAGAGACGTTTGAGGG - Intergenic
1107816661 13:44250575-44250597 CAGTTCAATGAGATGGTGGCTGG + Intergenic
1108156798 13:47593330-47593352 CATTCTAATGAGATTTTAGATGG - Intergenic
1108332450 13:49402897-49402919 CTTTTTAAAGAGATGTTAAATGG + Intronic
1109263911 13:60174655-60174677 CATTCTTTTGAGGTGTTGGAGGG - Intergenic
1112295282 13:98180745-98180767 CATTTTAGTGGGATTTTGGGAGG + Intronic
1112716294 13:102190018-102190040 CATTTCAACGAGATGTTGAGGGG + Intronic
1116033998 14:39606197-39606219 CATTTTAATTTGATGAGGGATGG + Intergenic
1116050578 14:39797795-39797817 CAATTTAATGCTGTGTTGGAGGG - Intergenic
1116516025 14:45806621-45806643 CATTTCAATGAAATGATGAAAGG - Intergenic
1116694567 14:48156377-48156399 CATTTTACTGAGATGGGGGTTGG - Intergenic
1117162839 14:53006103-53006125 CACTATAGTAAGATGTTGGATGG + Intergenic
1117367404 14:55042828-55042850 CATGAAAAAGAGATGTTGGAAGG - Intronic
1117433482 14:55694301-55694323 CATTTTAGTGAGATCTTCGGAGG - Intronic
1117761338 14:59031822-59031844 CATTTAAAGGAAATGTGGGATGG + Intergenic
1118130008 14:62952332-62952354 CAGTGACATGAGATGTTGGAAGG + Intronic
1118919702 14:70138967-70138989 ATATTTAATGGGATGTTGGATGG + Intronic
1119315094 14:73687301-73687323 AATTTTATTGAGAAGTTGAAAGG + Exonic
1119598666 14:75959357-75959379 CATGTCAGTGAGAGGTTGGAAGG + Intronic
1119820608 14:77612870-77612892 AGTTTTAATGAGATATTAGAAGG - Intronic
1121811443 14:96894675-96894697 TGTTTTAATAAGATTTTGGAGGG + Intronic
1122473379 14:101987752-101987774 TAGTTAAATGAGATTTTGGAGGG - Intronic
1124581828 15:30962597-30962619 CATGTTCATGGGACGTTGGAGGG - Intronic
1124889568 15:33719897-33719919 CATAATAATGGGATGGTGGAAGG - Intronic
1124905442 15:33863764-33863786 CATTTTTATGAGATGATAAATGG + Intronic
1125203429 15:37123140-37123162 CATTTGAATGACTTTTTGGAAGG + Intergenic
1126270503 15:46811866-46811888 TATTTTAATGATAAGTTGAAAGG - Intergenic
1130167008 15:81472018-81472040 CATTTCAATGAAAATTTGGAAGG - Intergenic
1134210931 16:12276202-12276224 CATTTTAATGGGATTTTGAGAGG + Intronic
1136254313 16:29028227-29028249 CATGGAAATGAGATGCTGGATGG + Intergenic
1139108904 16:63864546-63864568 CATTTTAAGAACATTTTGGAAGG + Intergenic
1139219524 16:65166111-65166133 CATTTTAGTGAAAAGTTGGGAGG + Intergenic
1139245974 16:65443994-65444016 CATTTTAATGGGATTTTGAGAGG + Intergenic
1139453835 16:67055220-67055242 CATTTTTATGACTTTTTGGAGGG + Intronic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143612944 17:8030540-8030562 CATTTGAATGGGGTTTTGGAGGG - Intergenic
1143933409 17:10455985-10456007 CATTTTAATGAGCTGTCTCAAGG + Intronic
1144488595 17:15687833-15687855 AATTTTACTGAAATGTTGAAGGG - Intergenic
1144912415 17:18694472-18694494 AATTTTACTGAAATGTTGAAGGG + Intergenic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1149206800 17:54257275-54257297 CATTTTAATTGGATTTTGGTAGG - Intergenic
1150937990 17:69658572-69658594 CATGCTAATGAGATGGTTGATGG + Intergenic
1151275398 17:73030296-73030318 CAGCTGAATGTGATGTTGGACGG - Intronic
1152147596 17:78577525-78577547 CATTTTGAGGGGAGGTTGGAGGG + Intergenic
1153049151 18:884834-884856 CACTTTCATTTGATGTTGGATGG - Intergenic
1155486935 18:26354465-26354487 CCTTATCATCAGATGTTGGATGG + Intronic
1155625540 18:27830096-27830118 CAATTTAATGAGATTTGGGTGGG + Intergenic
1155636088 18:27957146-27957168 ATTTTTAATGAGCTTTTGGATGG - Intronic
1156798194 18:41074653-41074675 CATTTTGATAAGATGTTGATAGG + Intergenic
1158000702 18:52615139-52615161 CATTTTCCTGAGATGTGGGCAGG + Intronic
1158172516 18:54615394-54615416 CATTTCAGGGACATGTTGGATGG + Intergenic
1158265461 18:55656556-55656578 CATTTTAATGGAGTATTGGAGGG + Intronic
1158938709 18:62387692-62387714 CATTTTACTCAGCTGTCGGAAGG + Exonic
1159215036 18:65381554-65381576 CATTTGACTGAGAAATTGGAAGG + Intergenic
1159704470 18:71669370-71669392 CATTTTAAAGAGATTTTAGAAGG + Intergenic
1163857551 19:19716613-19716635 CATTTTTTTGTGATGTTTGATGG - Intronic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1168190497 19:54735019-54735041 CATTTCAATGTGAGGTTTGAAGG + Intronic
925719368 2:6812853-6812875 CATTTTAATGGGATTTTAGGAGG - Intergenic
925786670 2:7437981-7438003 CATTGCTATGAGAGGTTGGAAGG + Intergenic
925810192 2:7692886-7692908 CAGCTTTGTGAGATGTTGGATGG + Intergenic
926428410 2:12761214-12761236 CATTTTTAAAAGATGATGGATGG - Intergenic
926720412 2:15956224-15956246 CATTTTAATGAGATGTTTGAGGG - Intergenic
927407035 2:22782352-22782374 CATTTGAATGTGTTGATGGAGGG + Intergenic
927702778 2:25278312-25278334 CATTTTAAAGAGAACTTGGGTGG - Intronic
927733855 2:25500556-25500578 CATTTTAATGAAATGGTAGGTGG - Intronic
928792370 2:34972950-34972972 TTTTTTTCTGAGATGTTGGATGG + Intergenic
929386043 2:41408550-41408572 CATTTTAATGGGATTTCGGAGGG - Intergenic
929703883 2:44189922-44189944 CATTTTGATGGCATGTTGGGAGG + Intronic
930979413 2:57504746-57504768 CATTTTACCGTAATGTTGGAAGG - Intergenic
932041373 2:68303283-68303305 AATTTTAATGAGGTCTTAGAGGG + Intronic
932099762 2:68887773-68887795 CATTTTAATGGTGTGTTGTAGGG + Intergenic
932140795 2:69276014-69276036 CATTTTAATGTGGTCTTGCAAGG - Intergenic
936780227 2:116023632-116023654 AATATTTATGAGATGTTTGAAGG + Intergenic
939291437 2:140201235-140201257 AAATTTTGTGAGATGTTGGAGGG - Intergenic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
941318787 2:164029058-164029080 CATTATCATGAAAAGTTGGAAGG - Intergenic
942359303 2:175155244-175155266 CATTCTAATAAGATTTGGGATGG - Intronic
942741228 2:179180690-179180712 CATTTTAATAAAATGTTGGGGGG + Intronic
943183916 2:184580486-184580508 TGTTTTAATGAGAAGTTGAAGGG + Intergenic
943595253 2:189847907-189847929 CATTTTATTAAAATCTTGGATGG + Intronic
944088239 2:195874312-195874334 CAGTTTAAGGAGATGGTGAAAGG + Intronic
944355470 2:198782644-198782666 CATTTGAATTACATGGTGGAAGG - Intergenic
944375126 2:199032692-199032714 CAGTTTAAGGAGATTTTGGGCGG - Intergenic
947573529 2:231254007-231254029 CATTTTGAGGTGATGTTGGATGG + Intronic
947661815 2:231875158-231875180 CATTTTTATGAGGTCATGGACGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947947415 2:234118089-234118111 CATTTTAATAAAATGTGGCATGG - Intergenic
1170053247 20:12170464-12170486 AAGTTTAATGAGATGCTGGCTGG + Intergenic
1170163003 20:13334785-13334807 CATTTTAATGAGATTTGGGTAGG - Intergenic
1170280034 20:14636164-14636186 CATTTTAATGTGATAATGAATGG + Intronic
1170476632 20:16721529-16721551 CATTTTCTTGAGAGGTTGAATGG + Intergenic
1170851685 20:20010297-20010319 CATTTTAGTGAGGTATTGGTAGG + Intergenic
1172398659 20:34629819-34629841 CATTTTAATGAGATTTTTGGAGG - Intronic
1172830356 20:37828875-37828897 CATTATAATGAAATGTAAGAAGG + Intronic
1176067305 20:63204855-63204877 CATTTTAAGGCAGTGTTGGAGGG - Intronic
1177703474 21:24669563-24669585 CAATTAAATGATATGCTGGAGGG - Intergenic
1178505994 21:33163486-33163508 CATTTTAAAGTGATGTCTGAAGG + Intergenic
1180580417 22:16830671-16830693 AATTTAAATCAGATTTTGGATGG - Intergenic
1182361962 22:29751981-29752003 CATTATTATGATTTGTTGGAAGG - Intronic
1183292951 22:37014014-37014036 CATTTAAATGAACTGTGGGAAGG + Intronic
949160223 3:873003-873025 CATATTAATGAGATGATTGGTGG - Intergenic
951018412 3:17755452-17755474 CATTTTAATGGGACATTGGAAGG - Intronic
952991495 3:38834798-38834820 AATCTCAATGAGATCTTGGATGG - Intergenic
953126663 3:40096988-40097010 CCTTTTACTGAGTTGTTGGCAGG - Intronic
953487080 3:43310630-43310652 CATTTTAATGATAATTTGGCTGG + Intronic
953614831 3:44480452-44480474 CATTTTAATGAGATTTTAGAAGG + Intergenic
953668885 3:44946093-44946115 CATTTTAATGGGTTGTTTGCTGG + Intronic
954468242 3:50670423-50670445 CATTTTAATAACATTTTGAATGG + Intergenic
955155785 3:56415243-56415265 TATTTTAATGAGTGGATGGATGG + Intronic
955467796 3:59254543-59254565 CATTCTAATCAAATGATGGATGG - Intergenic
955636030 3:61030647-61030669 CAGTTAAATGGTATGTTGGACGG + Intronic
960449578 3:117790066-117790088 GCTTTTACTGAGAGGTTGGAAGG + Intergenic
960794700 3:121473115-121473137 CATTTTAATGATAGGAAGGAAGG + Intronic
961909434 3:130299798-130299820 TATTTTAATGAGAAGTTAGGAGG - Intergenic
962476311 3:135758373-135758395 CATTTTAATGGGAACTGGGAAGG - Intergenic
963198417 3:142560329-142560351 CCTGTTATTGAGATGTTAGAAGG - Exonic
963301173 3:143598686-143598708 CATTTTAATAACATGTAGGTAGG - Intronic
964001147 3:151773504-151773526 CATTTTCATCAGATGTAGGTGGG - Intergenic
964470977 3:157055388-157055410 GCTTTTAATGGGATATTGGAAGG - Intergenic
965284463 3:166800297-166800319 CGTTTTAATGAGCATTTGGAGGG + Intergenic
965921645 3:173923627-173923649 AAATTTAATGAGATGTGAGAGGG - Intronic
966125197 3:176568280-176568302 AAGTTTAAAGAGATGTTGCAGGG - Intergenic
970979935 4:22084431-22084453 CATTTCAATGACATGTTGGTGGG - Intergenic
971296893 4:25401786-25401808 CATTTTAATGGTATTTTAGAAGG + Intronic
972101707 4:35428056-35428078 CAATTTTATGAGAAGTTAGAAGG - Intergenic
972178408 4:36435969-36435991 CAGCTTAAGGAGATTTTGGACGG + Intergenic
973746687 4:53970328-53970350 CATCTTAAGGAGATTTTGGGTGG + Intronic
974825755 4:67127535-67127557 CATTTTAATGGGATTTTGGGAGG - Intergenic
975510363 4:75188149-75188171 CATTTTAATGATGTGTTGGAAGG + Intergenic
976405341 4:84656134-84656156 CATTTTAATGAGCGCTTGAAGGG + Intergenic
977424160 4:96844939-96844961 CATGTTAAAGAGATGTCAGATGG - Intergenic
978141045 4:105317738-105317760 CATTCTAAGGAGATCTTAGAAGG - Intergenic
981469094 4:145109288-145109310 CAGTTTTATGAGATTTTGGGGGG + Intronic
981759631 4:148179628-148179650 CAATTTAATGAGAGTTTTGAAGG + Intronic
982611753 4:157583010-157583032 GATTTGAATGAGATCATGGAGGG + Intergenic
982780956 4:159491001-159491023 CATTCTAATGAGATCTCTGATGG + Intergenic
982925698 4:161334796-161334818 CATTTTAATGAAAAATTGAAGGG + Intergenic
984432965 4:179672222-179672244 CAATTCAAAGAGATTTTGGAGGG - Intergenic
984654696 4:182305388-182305410 CATTTTGGTGGCATGTTGGAAGG - Intronic
985893018 5:2730836-2730858 CCTTTAAATGAGATGTTAGGTGG + Intergenic
987163137 5:15165996-15166018 ACTTTTAATGGGAAGTTGGAAGG + Intergenic
987406749 5:17529469-17529491 CATTTTAATGGGATGTGGAGGGG + Intergenic
987674338 5:21054994-21055016 CATTTTAACAATATTTTGGAGGG + Intergenic
989427460 5:41313211-41313233 CTTTTTAATCAGATGCTGTATGG - Exonic
989609346 5:43276520-43276542 CATTTCAATGAGATTTGGGTGGG + Intronic
989697764 5:44223908-44223930 CTTTTTAATGTGAAGTTGTAGGG - Intergenic
989757084 5:44968347-44968369 CATTTTCATGACATTTTGAAAGG + Intergenic
990849631 5:60188242-60188264 CTCTTTAAGGAGATGTTGGTAGG + Intronic
992642568 5:78780624-78780646 CATTGTATTGAGACGGTGGAGGG + Exonic
993290666 5:86064834-86064856 AATTTTAATGAGAGTTTGGTAGG + Intergenic
994275009 5:97824915-97824937 CATTTTAAACAGATGTTGAAGGG - Intergenic
996602545 5:125281822-125281844 CTTAGTAATGAGATGTTTGAAGG + Intergenic
996835659 5:127789380-127789402 CATTTTGATGAGGTTTTAGATGG + Intergenic
997830998 5:137149926-137149948 CACTTTACTGAGATGTTGTGAGG + Intronic
999594299 5:153185079-153185101 CATTTTAAGAACATGTGGGATGG - Intergenic
999841921 5:155437152-155437174 CATTTTGATGAGACATTAGATGG + Intergenic
1000997003 5:167969533-167969555 CATTTTCCTGATATGTTGAAAGG - Intronic
1001412895 5:171523459-171523481 GAGTTTAATGAGATGATGGATGG + Intergenic
1002990975 6:2238440-2238462 CATTTTGGTGACAGGTTGGATGG - Intronic
1003504598 6:6729619-6729641 CATTTTAATGAGATCTGTGAAGG - Intergenic
1004893047 6:20120255-20120277 CATTTTAAAGGGCTGTTGAAAGG + Intronic
1005177751 6:23066821-23066843 CATTTTTATAATATGTTGAATGG - Intergenic
1005179278 6:23085291-23085313 CATTTTAATGAAGTTTTGCAAGG - Intergenic
1006886282 6:37384764-37384786 CCTTTTAAAGGGATGTTTGAAGG + Intronic
1006976347 6:38105934-38105956 CATTTTAGTGAGATGTTCATGGG + Intronic
1009033782 6:58092428-58092450 CATATTAATGAAATGATGCAAGG + Intergenic
1009165913 6:60340757-60340779 CATTTTAATGAGAAAGTAGAAGG - Intergenic
1009524448 6:64726296-64726318 CATGTAAATGAGATTCTGGAGGG + Intronic
1009906808 6:69879466-69879488 CATTTTCTGGAGATGTTGAAAGG + Intronic
1010698735 6:79013281-79013303 TATTTTAATGAGATGAAGGGTGG + Intronic
1010812922 6:80320917-80320939 CATTTTTATGAGATTATTGAAGG - Intronic
1011258932 6:85451898-85451920 CATTTTAATGAGATGAGAGAAGG + Intronic
1012172886 6:96041486-96041508 CATAGAAATGGGATGTTGGAAGG - Intronic
1012489536 6:99765751-99765773 AATTTTGATGAAATCTTGGAAGG + Intergenic
1012586575 6:100930535-100930557 CTTTTTAATGGGATTTTGGTTGG + Intergenic
1012838685 6:104301830-104301852 CATTCGAGTGAGATTTTGGAGGG + Intergenic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1013488316 6:110619131-110619153 CATTTAATAGATATGTTGGAAGG + Intronic
1013716961 6:112973615-112973637 CATTTCAATCAGATGCTGGAAGG - Intergenic
1014345245 6:120262290-120262312 CTTTTTAATGAGAACTTTGAAGG + Intergenic
1014624035 6:123704148-123704170 CATTTCAATGTGATGTTGGGAGG - Intergenic
1014815530 6:125931746-125931768 AATTCCAATGAGATGTTGGTGGG - Exonic
1015568003 6:134593867-134593889 CATTTTTATGAGTTGGTGAAGGG - Intergenic
1015916922 6:138227115-138227137 CATGTTCACAAGATGTTGGAAGG - Intronic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1017246145 6:152227647-152227669 CATATTAAAGACATATTGGAAGG - Intronic
1017462420 6:154663948-154663970 CATTTTAAAGGAAAGTTGGATGG + Intergenic
1020940466 7:14527856-14527878 CTTTTTATTGAGTTGTTGCATGG - Intronic
1021320272 7:19201010-19201032 CATTTTAATAAGATCTTGTTTGG + Intergenic
1023757999 7:43437956-43437978 CAATTAACTGAGAGGTTGGAGGG - Intronic
1027296286 7:76775354-76775376 TCTTTTAATGTGTTGTTGGATGG - Intergenic
1027426429 7:78065990-78066012 CATAATAATGAGATGTTTTAGGG + Intronic
1028669067 7:93380330-93380352 CATCTGAATAGGATGTTGGAAGG - Intergenic
1028827615 7:95291394-95291416 CATTTTAGAGAGATTTTGAATGG + Intronic
1029916677 7:104216851-104216873 CATTTAAATGAGATTATTGATGG + Intergenic
1030710276 7:112740788-112740810 GATTTTACTGGGATGTTGAAGGG - Intergenic
1031313263 7:120226442-120226464 TATTTCAAGGACATGTTGGAAGG - Intergenic
1031694504 7:124833241-124833263 AAATTTTATGATATGTTGGAAGG + Intronic
1031887089 7:127253810-127253832 CATTTTATTGAGATGATTCAAGG + Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1035773695 8:2170776-2170798 CATTTTAATTAGATGTCAGCTGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037736558 8:21571622-21571644 TATGTTAATGAGATGATGAATGG + Intergenic
1038587724 8:28805328-28805350 CATTTAAATGATAGCTTGGATGG - Intronic
1038904859 8:31889406-31889428 CATTTCCATGGGATGTTTGAAGG - Intronic
1039210627 8:35209143-35209165 CATAATAATGAGATGATGAAGGG + Intergenic
1039592550 8:38761915-38761937 AATTTTTAGGAGATGTTGGCTGG + Intronic
1041740596 8:61152721-61152743 CATTTTAACTAAATTTTGGAGGG + Intronic
1042904787 8:73761715-73761737 CATTATAATAAGACTTTGGAGGG - Intronic
1043520612 8:81041392-81041414 TATTTGAAAGAGATGCTGGAAGG + Intronic
1043655368 8:82658470-82658492 CATTTTTCTGAAATGTTGGAAGG - Intergenic
1043668638 8:82851650-82851672 CATTATATTGAGTTTTTGGAAGG + Intergenic
1044580798 8:93824260-93824282 TATTTTAATAAGATCTTAGATGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045513459 8:102834067-102834089 AATTTTAAAGAGATGTTATAGGG + Intronic
1046265796 8:111828129-111828151 CATATTCATGTGATTTTGGAAGG + Intergenic
1047700222 8:127442254-127442276 AAAGTTGATGAGATGTTGGAAGG - Intergenic
1047791678 8:128209820-128209842 CATTTCAATGTGAGATTGGAGGG + Intergenic
1048190634 8:132285350-132285372 CATTTTTATGAGATATCAGATGG + Intronic
1050282524 9:4066004-4066026 CATTTTAATGAGATGTTGGAAGG - Intronic
1051954848 9:22679777-22679799 TAATTTAATGAGAGGTTGGTTGG + Intergenic
1051963328 9:22794925-22794947 CATTCTTATGAGAAATTGGAAGG - Intergenic
1052597838 9:30583937-30583959 CATTTTAATGAGCTGTTATTAGG - Intergenic
1052717967 9:32140902-32140924 TATTTTAGTAAGATGTTGAAAGG - Intergenic
1052729022 9:32263825-32263847 TATTTTAATGAGTTTTTGGCAGG + Intergenic
1056034678 9:82591429-82591451 CATTTTGAAGATATATTGGATGG + Intergenic
1056073175 9:83010311-83010333 CATTTTAGTGAGGTTTTGGAAGG - Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056495681 9:87152806-87152828 GATTTTAGTGGGATCTTGGAAGG + Intronic
1058230507 9:102418464-102418486 CATTTCAATGAGACATTAGAGGG + Intergenic
1058326837 9:103708923-103708945 CATGTGAAGGAGATGTTGGATGG + Intergenic
1058375166 9:104314514-104314536 CAATTTAATAGGATTTTGGAAGG - Intergenic
1058572889 9:106366442-106366464 CATTTTTATGAGGTCTTAGATGG - Intergenic
1058878275 9:109263152-109263174 GATTTTAATGACATTTTGTATGG - Intronic
1060945505 9:127567821-127567843 CTTATTAATGAGTTGTTGGGAGG - Intronic
1186037521 X:5440935-5440957 CATTTTGATGAGATTTGGGTGGG + Intergenic
1186393458 X:9183855-9183877 TATTTTACAGAGCTGTTGGATGG - Intergenic
1186575428 X:10760456-10760478 CATGTTTATGAGATGTTTGTGGG - Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186716459 X:12257031-12257053 AATTTAAATGAGAAGCTGGATGG - Intronic
1187033473 X:15512556-15512578 CATTTCAATGAGCTGGTGGTGGG - Intronic
1187166470 X:16808945-16808967 ATTTTTCATAAGATGTTGGAGGG - Intronic
1187407764 X:19019324-19019346 CATTTTAAAAACATGTTTGACGG - Intronic
1187659663 X:21528182-21528204 CATTTTAGTAGGATATTGGATGG - Intronic
1188496184 X:30785306-30785328 TATTTTAATGAGATCTTGATGGG + Intergenic
1189842346 X:45093747-45093769 CATTTTAATGATAAACTGGAAGG - Intronic
1190271205 X:48865238-48865260 CCTTTTAATGAGATGCTCCATGG + Intergenic
1192414096 X:70962718-70962740 CATTTTAATGGGATGTCAAAAGG - Intergenic
1192584676 X:72309569-72309591 GAATTAAATGAGATGATGGATGG - Intergenic
1194069311 X:89300222-89300244 CATTTCAATGTGAGATTGGATGG + Intergenic
1194923844 X:99799346-99799368 CATTTTAGTGAGGTGTGAGAAGG + Intergenic
1196074072 X:111555726-111555748 CATGTTAATGAGATGACTGATGG + Intergenic
1197403265 X:126020181-126020203 CATTTTAAACACATTTTGGAAGG + Intergenic
1197504783 X:127288291-127288313 GAGTTTAATGAGATGTGGGGGGG + Intergenic
1198857619 X:141034276-141034298 AATTCTTATGTGATGTTGGAGGG + Intergenic
1198905079 X:141553095-141553117 AATTCTTATGTGATGTTGGAGGG - Intergenic
1200723460 Y:6634364-6634386 CATTTCAATGTGAGATTGGATGG + Intergenic