ID: 1050285635

View in Genome Browser
Species Human (GRCh38)
Location 9:4099027-4099049
Sequence CACTTTGTCTTGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050285635_1050285643 22 Left 1050285635 9:4099027-4099049 CCCACTGCCCTCAAGACAAAGTG 0: 1
1: 0
2: 0
3: 32
4: 300
Right 1050285643 9:4099072-4099094 CTGCAGTCATGATGGCAAGAAGG No data
1050285635_1050285639 -5 Left 1050285635 9:4099027-4099049 CCCACTGCCCTCAAGACAAAGTG 0: 1
1: 0
2: 0
3: 32
4: 300
Right 1050285639 9:4099045-4099067 AAGTGCAATGTCCCACAGCTTGG No data
1050285635_1050285642 14 Left 1050285635 9:4099027-4099049 CCCACTGCCCTCAAGACAAAGTG 0: 1
1: 0
2: 0
3: 32
4: 300
Right 1050285642 9:4099064-4099086 TTGGCTTACTGCAGTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050285635 Original CRISPR CACTTTGTCTTGAGGGCAGT GGG (reversed) Intronic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
901460800 1:9390389-9390411 CACTCAGGCTGGAGGGCAGTGGG - Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
904092721 1:27956439-27956461 AACTTTATCTTGAAGGCACTGGG - Intronic
904621523 1:31778204-31778226 CACTTTCTCCTGAGCACAGTGGG + Intergenic
905029350 1:34871163-34871185 AACTTTGTCTTGTTGGTAGTAGG - Intronic
905311241 1:37050524-37050546 CTCATTGCCTTGAGGGCAGAGGG - Intergenic
905662638 1:39739104-39739126 CACTTTTTCCTGAGGACAGTGGG - Intronic
905662746 1:39739805-39739827 CACTTTATCCTGAGGACAGTGGG + Intronic
907433573 1:54429511-54429533 GACTTTATCTTGAGAGCAATGGG + Intergenic
907462812 1:54615366-54615388 CACTTTTTCCTGAGGACAATGGG + Intronic
907496881 1:54851325-54851347 CACTTTGTCTTGGTGGGAGTGGG - Exonic
907752990 1:57281602-57281624 GACTTTTTCCTGAGGGCAGGAGG + Intronic
907955010 1:59219708-59219730 CTCTTTATCCTGAGAGCAGTGGG - Intergenic
908035097 1:60043218-60043240 CGCTTTATTCTGAGGGCAGTGGG + Intronic
908206119 1:61851593-61851615 GACTTTATCTTGAAGGCAGTAGG + Intronic
908330856 1:63069463-63069485 CACTCTGTCTTCTGAGCAGTGGG - Intergenic
909307416 1:74098929-74098951 TACTTTGTCTTGTGGGCATTTGG - Intronic
911672299 1:100620816-100620838 CACTTAATTCTGAGGGCAGTTGG - Intergenic
913182758 1:116338061-116338083 CATTTTATTTTGAGGGCTGTAGG - Intergenic
913201376 1:116497459-116497481 CATTTTGTCTTGGGGTCACTGGG + Intergenic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
916417594 1:164607130-164607152 AATTTTATCTTGAAGGCAGTTGG + Intronic
916867775 1:168878760-168878782 CACCTAGACTGGAGGGCAGTGGG - Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
921177489 1:212607558-212607580 CACCCTGGCTTGAGGGCAGAGGG + Intronic
1063125485 10:3133159-3133181 CACTTTGTTTAGCGTGCAGTGGG - Intronic
1065003522 10:21358836-21358858 CACTCAGGCTGGAGGGCAGTGGG + Intergenic
1068758446 10:60681292-60681314 GACTTGGACCTGAGGGCAGTGGG - Intronic
1068826138 10:61441524-61441546 GTCTTTGTCTTGATGGCATTAGG + Intronic
1068982827 10:63079225-63079247 CACTTAGACTAGAGTGCAGTGGG - Intergenic
1069471531 10:68695747-68695769 CACTTTGTGTTGAGAACTGTAGG + Intergenic
1069504703 10:68987392-68987414 CACTTTGTCTCCAGGCCAGATGG - Intergenic
1070664566 10:78333928-78333950 GACTTTGTTTTGAGTGCGGTGGG + Intergenic
1070824065 10:79380749-79380771 CGCTTTGTCTTGTGTTCAGTGGG + Intergenic
1072024488 10:91441192-91441214 CACTTTCTCCTGTGGGCATTTGG + Intronic
1072025209 10:91448403-91448425 CACTTTCTCCTGTGGGCATTTGG - Intronic
1075513281 10:123089231-123089253 CCTTTTGTCTTGAGGGAATTGGG - Intergenic
1077672454 11:4168255-4168277 CACTTTATCTGGTGGGCAGTGGG - Intergenic
1077864131 11:6209257-6209279 AATTTTGTCCTGAAGGCAGTGGG - Intronic
1078664185 11:13310777-13310799 GACTTTATCCTGAAGGCAGTGGG + Intronic
1079104555 11:17561853-17561875 CAGTCTCTCTTGGGGGCAGTAGG - Intronic
1079110598 11:17603041-17603063 GACTTTATCCTGAGGGCAATGGG + Intronic
1079126953 11:17723886-17723908 GACTTTATCTCGAGGGCAGTAGG + Intergenic
1079417642 11:20254405-20254427 GTCTTCATCTTGAGGGCAGTAGG + Intergenic
1080857922 11:36128492-36128514 GACTTTATCTCGAGAGCAGTGGG + Intronic
1083573337 11:63771646-63771668 CAGTTTGTCCTGAAGGCACTGGG + Intergenic
1083851736 11:65371950-65371972 CACCTAGTCTGGAGTGCAGTGGG + Intergenic
1084070962 11:66734349-66734371 GACTTTGTCCCAAGGGCAGTGGG - Intergenic
1084207506 11:67604541-67604563 AGCTTTGTTCTGAGGGCAGTGGG + Exonic
1084332664 11:68439054-68439076 AGCTTTGTCTTGAGTGCAGCTGG + Intronic
1085324388 11:75595433-75595455 CACATTGTAAGGAGGGCAGTTGG - Intronic
1085514451 11:77104242-77104264 CCCTTTGCCTTGAGGGAAGTTGG + Intronic
1085730600 11:78995315-78995337 GATTTTGTCCTGAGGGCAATGGG + Intronic
1085898175 11:80664448-80664470 GACTTTATCTTGAGAGCACTGGG + Intergenic
1086091198 11:83006887-83006909 TACTTGGTTTTGAGGGAAGTTGG - Intronic
1087250692 11:95895953-95895975 ATCTTTATCTTGAGAGCAGTAGG - Intronic
1087741439 11:101892089-101892111 GAATTTTTCTTGAGGGCATTTGG - Intronic
1088847089 11:113677772-113677794 CACTTTGTCTTATGGGGAATGGG - Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089163288 11:116456016-116456038 CACTTTGTCCTGGGGACAGAGGG + Intergenic
1089263350 11:117238783-117238805 CCCTTTGTCTTTCTGGCAGTGGG + Exonic
1089734145 11:120538233-120538255 CACTTGGGCGTCAGGGCAGTGGG + Intronic
1090136166 11:124201129-124201151 TACCTTGTCTTAAGGGCAGAGGG - Intergenic
1091063612 11:132488219-132488241 TACTTTGTCTATAGGGCAGGAGG - Intronic
1091453740 12:590023-590045 GGCTTTGTCCTGAGGGCAGCAGG + Intronic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1091820845 12:3474135-3474157 GACTTTATCCTGAAGGCAGTGGG - Intronic
1091988485 12:4934158-4934180 TACTTTGTCTTGAGAGCTGGAGG - Intergenic
1092698486 12:11200801-11200823 GACTTTTTGTTTAGGGCAGTTGG + Intergenic
1092845666 12:12582590-12582612 CACTTCCTTTTGAGGGCTGTGGG - Intergenic
1094402845 12:30081020-30081042 CCCTTTATTTTGAGGGGAGTGGG + Intergenic
1094869464 12:34583373-34583395 TGCTTTGTATTGAGTGCAGTCGG - Intergenic
1095069454 12:37823003-37823025 CAATTTGCCTTGAGGCCTGTGGG + Intergenic
1096753678 12:53780948-53780970 GACTTTATCCTGAGGGCAGAAGG + Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098333954 12:69382577-69382599 GACTTTCCCTTCAGGGCAGTGGG + Intronic
1100331021 12:93582314-93582336 GAATTTATCCTGAGGGCAGTAGG + Intronic
1100777870 12:97992120-97992142 GATTTTGTCTTTAGGGCAATGGG - Intergenic
1102160326 12:110763648-110763670 CACTTTCCCTTGAGCTCAGTGGG - Intergenic
1102752980 12:115312101-115312123 CACTGTGTCATGTGGGCAATCGG + Intergenic
1103911780 12:124355951-124355973 GACTTTCTCCTGAGGACAGTGGG - Intronic
1106268950 13:28135931-28135953 AACTTTTTCTTGAGGACAATTGG - Intergenic
1106372092 13:29144821-29144843 CTCTTTGTCTTGAGTGCAGGTGG - Intronic
1108493558 13:51003780-51003802 CACTTTGTCCTGAGGGTCGTAGG - Intergenic
1109326486 13:60873421-60873443 GACTTTGTCTTGAGGGTGCTGGG + Intergenic
1110326252 13:74219000-74219022 CACTCAGGCTGGAGGGCAGTGGG + Intergenic
1110638177 13:77790642-77790664 CACTTTCTCTGGAGTGTAGTAGG + Intergenic
1112794373 13:103039448-103039470 CCCTTTGTCTTTAAGGCAGCAGG + Intergenic
1115263526 14:31477322-31477344 GACTTTATCTTGAGGGCATTTGG - Intergenic
1119134803 14:72207514-72207536 AAATTTATCTTGAGGGCAATGGG - Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1121123476 14:91391059-91391081 CGCTTGGTGTTGAAGGCAGTGGG - Intronic
1121992527 14:98573622-98573644 CACACTGTCTTGAGGGTAGAAGG + Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1128100286 15:64992998-64993020 AACTTTAGCTTGAAGGCAGTGGG - Intergenic
1129167920 15:73789430-73789452 GACTTTGCCTAGAGGGCAATAGG + Intergenic
1129666959 15:77584740-77584762 GACTTTGTCCTGAGGGAAATGGG - Intergenic
1131335102 15:91541360-91541382 CAGCTTGAGTTGAGGGCAGTGGG + Intergenic
1131391351 15:92051407-92051429 GACTTCATCTTGTGGGCAGTTGG + Intronic
1133534752 16:6691082-6691104 CACTGTGTCTTGAGAGATGTTGG + Intronic
1133820088 16:9228216-9228238 GACTTTATCCTGAGGGCAATGGG + Intergenic
1135970698 16:27070121-27070143 GACTTTGTCTGGAGGAAAGTAGG - Intergenic
1136005293 16:27325055-27325077 AACTCTGTCTCTAGGGCAGTGGG - Intronic
1137336147 16:47551330-47551352 CACTTTCTCCTGTGGGCATTTGG + Intronic
1138930606 16:61651324-61651346 CACTTTTTCTTGAGGTCAAAGGG - Exonic
1139523766 16:67500519-67500541 CACTTTATCTTGGTGGCAGCAGG - Intergenic
1139614986 16:68083549-68083571 GACTTTATCCTGACGGCAGTAGG - Intergenic
1142723227 17:1791844-1791866 CACTTAGGCTGGAGTGCAGTGGG - Intronic
1143023139 17:3926945-3926967 GACATTGTCCTCAGGGCAGTGGG - Intronic
1145260542 17:21352080-21352102 CAGTTTGTCTTCTGGGCACTGGG + Intergenic
1146974083 17:37096247-37096269 GACTTTGTCCTGAGGCCTGTCGG - Intronic
1147427001 17:40350682-40350704 CCCTTTGTGGGGAGGGCAGTGGG + Intronic
1149188601 17:54031192-54031214 GTCTTTCTCTTAAGGGCAGTGGG - Intergenic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150996183 17:70320283-70320305 CAATTTGGCTAGTGGGCAGTTGG - Intergenic
1151072584 17:71232945-71232967 CACTTTGTCTTCACGGAAGAGGG - Intergenic
1153534230 18:6083459-6083481 GACTTCATCTTGTGGGCAGTGGG + Intronic
1153917195 18:9756858-9756880 AACTTTGTTCTGAGGGCAATGGG - Intronic
1153938425 18:9953176-9953198 CACTATGTCTTTAGAGCAGAAGG - Intronic
1154208978 18:12362895-12362917 CACTTTCTCATGAGGCCGGTAGG - Intronic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1157460310 18:47885962-47885984 TACTTTGTTTTGGAGGCAGTGGG - Intronic
1157856121 18:51107206-51107228 CCCTTTGTCTTGCTGGCTGTTGG + Intergenic
1158527018 18:58224045-58224067 CACTTAGTCTGAAGGGCAGGGGG - Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160618783 18:80155020-80155042 CACTTTGTCTTGAGAGCAAGGGG + Intronic
1160741393 19:687760-687782 GGTTTTGTCTTGAGGGCAATCGG - Intronic
1161602570 19:5193482-5193504 CTCTTTGTCTGGGGGGCTGTGGG + Intronic
1161641371 19:5425475-5425497 GACTTTCTCTTGAGGGCACTGGG - Intergenic
1161642766 19:5434786-5434808 GACTTTGTCCTGAGGGCGATAGG + Intergenic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1163220194 19:15913475-15913497 AACTTTATCCTGTGGGCAGTAGG - Exonic
1163447010 19:17352841-17352863 GACTTTCTCCTGAGGGCACTGGG - Intronic
1163568096 19:18063747-18063769 TACTTTCTCCTGAGGGCAGTAGG + Intronic
1163764490 19:19155161-19155183 AACTTTCTCATAAGGGCAGTGGG - Intronic
1166007500 19:39917459-39917481 GACTTTATCTAGAGGGCAATGGG + Intronic
1166050416 19:40255790-40255812 GACTTTGTCCTCAGGGCAGCAGG + Intronic
1166565570 19:43763510-43763532 GACTTTGACAGGAGGGCAGTGGG + Intergenic
1166853746 19:45772212-45772234 CCTTTTGTCGTGAGGGCATTAGG - Intronic
1166869470 19:45862882-45862904 AACTTTGCCTCGAGGGCACTAGG + Intronic
1167039347 19:47013423-47013445 CAGTGTGTCCTGAGGGCACTGGG + Intergenic
1167077698 19:47259295-47259317 GACTTTGTCCTGAGGGCACTGGG + Intronic
1167602726 19:50464115-50464137 CTCTTTGTCCTGAGAGCAATGGG + Intronic
1167711397 19:51113512-51113534 GACTTTATATTGAGGGCACTGGG - Intergenic
1168488838 19:56790170-56790192 CACTTTATTTGGAAGGCAGTGGG - Intronic
925921190 2:8639095-8639117 CACTTTGTCTGGAGAGGAGGAGG - Intergenic
925945243 2:8856426-8856448 CACTTTCTCTTAATAGCAGTCGG + Exonic
927503552 2:23598340-23598362 CACTCTGTCCTGAAGTCAGTGGG - Intronic
927650002 2:24906754-24906776 CACCTTCTCTGGAGGGCAGCGGG - Intronic
929615893 2:43306997-43307019 CACCTTGTCTTGAGGCCTCTTGG - Intronic
929765755 2:44842929-44842951 CACTTTGTCTTGCAGGGGGTTGG - Intergenic
930230650 2:48840942-48840964 GACTCTCTCTTCAGGGCAGTTGG + Intergenic
932344439 2:70986361-70986383 GACTTTATCCTGAGGGCAGCAGG + Exonic
934085666 2:88507085-88507107 AACTTTATCCTTAGGGCAGTAGG + Intergenic
935122101 2:100192022-100192044 CACTTTATCCCGAGGGCACTGGG - Intergenic
935411899 2:102772662-102772684 CACTTTGTCTTAAGAACACTCGG + Intronic
935697108 2:105779603-105779625 CACTTGGCCTTGTGGGCAGATGG + Intronic
937417901 2:121731562-121731584 GAATTTATCCTGAGGGCAGTGGG - Intronic
938982961 2:136544123-136544145 AATTTTGTCTTCAGGGCACTTGG - Intergenic
939378336 2:141400024-141400046 CACCCTGTCTGGAGCGCAGTGGG + Intronic
940991556 2:160102560-160102582 GGCTTTGCCTTGGGGGCAGTGGG + Intronic
942735646 2:179108991-179109013 TACTTTGTCTTTAGGGGAGGAGG - Exonic
943266275 2:185737317-185737339 CACTTTGCGCTGAGGGCAGTTGG + Intergenic
943700781 2:190986383-190986405 CACCTTTTCTCCAGGGCAGTAGG - Intronic
944990498 2:205230024-205230046 GACTCTCTCTTCAGGGCAGTGGG + Intronic
945763201 2:213941022-213941044 CACCTTCTCTTGAGGCCATTGGG + Intronic
946028830 2:216689469-216689491 CACTCTGTTTTAGGGGCAGTAGG - Intronic
946955887 2:224929561-224929583 CACTTCATTTTGAAGGCAGTGGG + Intronic
947098745 2:226595647-226595669 CATATAGTCTTGGGGGCAGTGGG + Intergenic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
947928007 2:233938257-233938279 GACTTTGTCCTGAAGGCAGAGGG - Intronic
948447087 2:238041089-238041111 CACTGTGTCTTGCGTGCAGTAGG + Intronic
948778362 2:240301743-240301765 CACTGTGTCCTGGGGGCAATGGG + Intergenic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
1170582870 20:17712019-17712041 GACTGTGTCTTCAAGGCAGTGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172110930 20:32544468-32544490 AGCTTTGTCCTGAAGGCAGTGGG + Intronic
1172436221 20:34930714-34930736 GATTTTATCTTAAGGGCAGTGGG - Intronic
1172820292 20:37726940-37726962 CAATTAGGCTTGGGGGCAGTGGG - Intronic
1173151769 20:40572213-40572235 TTCTGTGTCTTGAGGGCAATGGG - Intergenic
1173633377 20:44532998-44533020 GGCTTTGTGTTGGGGGCAGTGGG + Intronic
1173830485 20:46082551-46082573 CTTTTGGTCTTAAGGGCAGTTGG - Intronic
1174051099 20:47768176-47768198 CACTTTGTCTTGAGTGGGGTCGG + Intronic
1174726646 20:52869546-52869568 GACTTTATCTTGAGGGTACTAGG + Intergenic
1175514023 20:59557329-59557351 CACTGTGTGTTGGGGGCAGGGGG + Intergenic
1176361992 21:6005742-6005764 GACATTGTGTGGAGGGCAGTAGG + Intergenic
1176985858 21:15434645-15434667 CACTTTGTATTAAAGGAAGTTGG - Intergenic
1178047673 21:28713381-28713403 CACTTTATCCTAAGTGCAGTGGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG + Intronic
1179709999 21:43207897-43207919 CCATGTGGCTTGAGGGCAGTGGG + Intergenic
1179761526 21:43532803-43532825 GACATTGTGTGGAGGGCAGTAGG - Intronic
1181018872 22:20087855-20087877 AACTTTGAGTTGAGGGTAGTGGG + Intronic
1181097125 22:20513110-20513132 CACTTGGGCTGGAGTGCAGTTGG + Intronic
1181533687 22:23531112-23531134 CACTGGGTCCTGAGGGCAGGTGG + Intergenic
1181603004 22:23963462-23963484 GCCTTTCTCATGAGGGCAGTGGG + Intergenic
1181605510 22:23977845-23977867 GCCTTTCTCATGAGGGCAGTGGG - Intronic
1182110241 22:27718019-27718041 AACTTTGTTTTGAAGGCAATGGG + Intergenic
1183306018 22:37083629-37083651 CACTATGGCATGAGGCCAGTAGG - Intronic
1183502974 22:38192281-38192303 CACTTTGTCCTGACAGCACTGGG + Intronic
1184147632 22:42620575-42620597 CTCTTGGTGTTGAGGGCTGTGGG - Intronic
950104168 3:10377777-10377799 GACTTTATCCTGAGGACAGTGGG - Intronic
950119855 3:10474582-10474604 AACCTTGTTCTGAGGGCAGTGGG - Intronic
950520609 3:13495643-13495665 CACATTGTCGTCAGGGCAGTAGG - Intronic
950675678 3:14552961-14552983 GACCCTGTCTTGGGGGCAGTGGG - Intergenic
952030844 3:29141077-29141099 CACTCTGCCTTGAAGGGAGTAGG + Intergenic
952890683 3:38038284-38038306 GACTTTATTTTGAGGGCAGTAGG - Intergenic
955795673 3:62633993-62634015 TACTTTGACTTGAGGTTAGTGGG + Intronic
956817833 3:72924506-72924528 GTCTTTTTCTTAAGGGCAGTGGG + Intronic
956978134 3:74606031-74606053 CACTTTTTTTTGAGGGGAGAGGG - Intergenic
959801283 3:110498053-110498075 CACTTTTTCCTGTGGGCATTTGG - Intergenic
960651310 3:119953560-119953582 GACTTTATCTTGTAGGCAGTGGG - Intronic
961566118 3:127764254-127764276 CCCTTTGTCTTTAGGCCATTAGG - Intronic
961713411 3:128843802-128843824 CATTTTTTCTTGAGGCCTGTAGG + Intergenic
962446309 3:135469008-135469030 AACTTGGTCCTGAAGGCAGTGGG + Intergenic
962678871 3:137778270-137778292 CACTATCTCTTGAGGGTAGAGGG + Intergenic
962870825 3:139491569-139491591 CTCTTTCCCTTCAGGGCAGTGGG + Intergenic
964190169 3:153992327-153992349 CCCATTGTCTTGAGGACATTTGG - Intergenic
964714240 3:159705327-159705349 CACATTGTCTTCAGGAAAGTAGG + Intronic
964828215 3:160853194-160853216 CACTTTTTCTTTTTGGCAGTGGG + Intronic
965091582 3:164169917-164169939 GACTTTATCTTGAAGGCAGTGGG - Intergenic
965175786 3:165330464-165330486 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
966045685 3:175545908-175545930 CACTTTGTCTTGCAGAAAGTAGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
969171065 4:5364096-5364118 GACTTTGTCCTGTGGACAGTGGG - Intronic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
972740959 4:41885663-41885685 CACTGTTTCTTGCTGGCAGTGGG - Intergenic
973726469 4:53782010-53782032 CACTTTGTCCCGAAGGCACTTGG - Intronic
973999226 4:56493979-56494001 CACTTCTTCCTGAGGACAGTGGG + Intronic
975948865 4:79743557-79743579 CGCTTTATCTTGTGGGAAGTGGG - Intergenic
976125191 4:81826988-81827010 CTCTTTGTTTTGAGGGCACGTGG + Intronic
978934576 4:114359373-114359395 CACTCTTCCTTCAGGGCAGTGGG + Intergenic
981600349 4:146481357-146481379 CACTTTGGCTTGTGGGGCGTGGG - Intronic
982263458 4:153516864-153516886 CACTTAGGCTGGAGTGCAGTGGG + Intronic
982302305 4:153892223-153892245 CACTTGGTCCAGAGGGCATTTGG - Intergenic
983461358 4:168028795-168028817 CACATTGTCTAGAGAGCATTTGG - Intergenic
983897789 4:173100088-173100110 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
984583928 4:181541342-181541364 CACCTAGGCTGGAGGGCAGTGGG - Intergenic
985650671 5:1105833-1105855 CAGCTGGTCTTCAGGGCAGTGGG - Intronic
986961268 5:13215789-13215811 CACTTTGGCTTGTGTGCAGCTGG - Intergenic
987446795 5:18030272-18030294 CATTTTGTCTTGTGTGCACTTGG - Intergenic
988163455 5:27551643-27551665 CACTTTGTTTTGGCAGCAGTGGG + Intergenic
992766947 5:80010178-80010200 GACTTTGTCTTAAGGGTAATGGG - Intronic
994146506 5:96401455-96401477 TACTTTATCTTTTGGGCAGTGGG + Intronic
994298274 5:98116454-98116476 TGCTTTGTCTTGTGGGCATTTGG - Intergenic
996531376 5:124530741-124530763 CACTTTAGCATGAAGGCAGTGGG - Intergenic
997666310 5:135632202-135632224 GGCTTTGTCTTGAGGGCCATGGG + Intergenic
998139531 5:139692066-139692088 TATTTTGTCTTGGGGACAGTGGG + Intergenic
998811740 5:145973289-145973311 GACTTTATCTTGGGGACAGTAGG + Intronic
999659165 5:153840812-153840834 GACCTTATCTTGAGGGTAGTGGG - Intergenic
999791903 5:154948044-154948066 GACTTCGTATTGTGGGCAGTAGG + Intronic
1000324789 5:160163996-160164018 CACTCTGTCTTTAGGGCAACTGG + Intergenic
1001939271 5:175729236-175729258 GCCTCTGTCCTGAGGGCAGTGGG - Intergenic
1002305228 5:178279150-178279172 AGCTTTGCCCTGAGGGCAGTGGG - Intronic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1002847758 6:963168-963190 CACTCTGTTTTGAAAGCAGTTGG - Intergenic
1003572212 6:7263136-7263158 CACTGTGTGTTCTGGGCAGTGGG - Intergenic
1004326653 6:14680945-14680967 CACTTTTTCTTGTGAGCATTGGG - Intergenic
1007312094 6:40954825-40954847 GACTTTGTCTTAAGAGCAATGGG + Intergenic
1008578161 6:52881256-52881278 CACCTTGTCCTGAGAGTAGTTGG + Intronic
1008894819 6:56540834-56540856 CACTTTGACATGAAAGCAGTGGG + Intronic
1010850296 6:80767452-80767474 CACAGTGTCTGGAGGACAGTAGG - Intergenic
1011035502 6:82969565-82969587 CACTCGGTCTGGAGTGCAGTGGG - Intronic
1011401655 6:86969376-86969398 AACTTTATCAGGAGGGCAGTTGG - Intronic
1012519705 6:100106339-100106361 TACTTTGTCCTGAGGGGATTGGG + Intergenic
1012532205 6:100251556-100251578 AACTTTGTCATGAAGGCATTAGG + Intergenic
1012619889 6:101330559-101330581 CACTTTGTCTTGAAGGAACCAGG - Intergenic
1012939249 6:105400310-105400332 CACTTTATCCTGAAGGCAGTGGG - Intronic
1014038084 6:116791247-116791269 GTCTTTGTCCTGTGGGCAGTGGG - Intergenic
1014583066 6:123162067-123162089 GACTTTTCCTTCAGGGCAGTGGG - Intergenic
1015906620 6:138123582-138123604 ACATTTCTCTTGAGGGCAGTGGG - Intergenic
1016447337 6:144147615-144147637 CAAGTTGTCATGAAGGCAGTTGG - Intergenic
1017482665 6:154872902-154872924 CAGTTTCTCTTGTAGGCAGTAGG + Intronic
1018951430 6:168381032-168381054 CACTTTGACTTGGGCCCAGTGGG - Intergenic
1019700153 7:2470892-2470914 CGCTTTGTGCTGAGGGCGGTGGG + Intergenic
1020512884 7:9081911-9081933 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1022578813 7:31526929-31526951 AACTTTGTTCTGAGGGCAGTGGG - Intronic
1025980334 7:66399994-66400016 GACTTTGTCTTAAAGGCAATGGG + Intronic
1026043188 7:66886127-66886149 GACTTTGTCTTAAAGGCAATGGG - Intergenic
1028855734 7:95590976-95590998 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1031274781 7:119706539-119706561 TATTTTCCCTTGAGGGCAGTTGG + Intergenic
1031492662 7:122408463-122408485 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1032105647 7:129026831-129026853 CACTCAGGCTGGAGGGCAGTGGG + Intronic
1032543637 7:132724545-132724567 CATTTGTTCCTGAGGGCAGTAGG - Intronic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1035696224 8:1598983-1599005 CACTTTCTCCTGTGGGCATTTGG + Intronic
1037475741 8:19255669-19255691 CAGCTTCTCTTGAGGGCAGGAGG - Intergenic
1039702871 8:39979393-39979415 CACTCAGGCTGGAGGGCAGTGGG + Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1041133157 8:54724694-54724716 CATTTTGTCTTTAGGCCAGGTGG - Intergenic
1041515301 8:58692690-58692712 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
1042980278 8:74518947-74518969 CACTCTCTCTTCAGGGCAGTGGG - Intergenic
1045184876 8:99827699-99827721 CACTTTTTCCTGTGGGCATTTGG + Intronic
1047975992 8:130131426-130131448 AACTTTGTTTTGAGTGCTGTAGG - Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1050172999 9:2842370-2842392 AACTTTTTCCTGAAGGCAGTGGG - Intronic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1050436194 9:5613311-5613333 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1051155844 9:14144969-14144991 CATTTTTTCCTGAGAGCAGTGGG + Intronic
1052706614 9:32000937-32000959 GACTTTATTTTGAGGGCAGCAGG + Intergenic
1053169588 9:35869114-35869136 CACTTTGTTCTGAGAACAGTGGG + Intergenic
1054454736 9:65424037-65424059 GGCTTTGTCTCGAGGGCAATGGG - Intergenic
1057695754 9:97321987-97322009 GGCTTTATCCTGAGGGCAGTGGG + Intronic
1058310926 9:103501496-103501518 CACCTAGTCTGGAGTGCAGTGGG - Intergenic
1059150797 9:111948073-111948095 GGCTTTGTCGTGAAGGCAGTAGG + Intergenic
1059457615 9:114409555-114409577 CACTTAAGCCTGAGGGCAGTGGG + Intronic
1060401186 9:123350440-123350462 GACTGTGTCCTGAGGGCACTGGG - Intergenic
1060799628 9:126535333-126535355 CATTTTCTTCTGAGGGCAGTGGG - Intergenic
1060994568 9:127868703-127868725 GACTTTCTCCTGAGGGCACTGGG - Intronic
1061246779 9:129404727-129404749 CACTGGGTCCTGAGGGCAGGTGG - Intergenic
1186126595 X:6420899-6420921 CATTCTGTCTTGAATGCAGTAGG + Intergenic
1187906372 X:24070380-24070402 AGCTGTGTCTTGAGGGGAGTAGG - Intronic
1188088772 X:25936696-25936718 CGCTTTCTCTTGTGGGCATTTGG - Intergenic
1188305103 X:28552130-28552152 TACTTTTTCTTGAGGTCTGTAGG - Intergenic
1189437398 X:41005301-41005323 CACCCAGGCTTGAGGGCAGTGGG - Intergenic
1190546630 X:51534686-51534708 TACTTTCTCTTGTGGGCATTTGG + Intergenic
1191218727 X:57962574-57962596 CACTCTGTCTTGAAAGCAATAGG + Intergenic
1192825355 X:74690451-74690473 TGCTTTCTCTTGTGGGCAGTTGG + Intergenic
1193247358 X:79244555-79244577 GTCTTTCTCTTCAGGGCAGTGGG - Intergenic
1193589040 X:83364811-83364833 CGCTTTCTCTTGTGGGCATTTGG + Intergenic
1195538872 X:106039724-106039746 GACTTTACCTTGAGGGCACTGGG + Intergenic
1196639269 X:118039350-118039372 GTCTTTCTCTTCAGGGCAGTGGG - Intronic
1198376395 X:136044326-136044348 GACTTTATCCTGAGGGCAGTGGG + Intronic
1198685993 X:139228691-139228713 CACTTTGTTCTGAAGGCAGTGGG + Intergenic
1201578442 Y:15485724-15485746 CACTTTGGGCTGGGGGCAGTGGG + Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic
1201963959 Y:19711131-19711153 TTCTTTGTCTTGTAGGCAGTTGG - Intronic
1202065225 Y:20932387-20932409 CTCTTTCTCTTGTGGGCATTTGG - Intergenic