ID: 1050286323

View in Genome Browser
Species Human (GRCh38)
Location 9:4106107-4106129
Sequence TTGTCTAAGGTGTTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050286323_1050286331 26 Left 1050286323 9:4106107-4106129 CCTTCCACCAACACCTTAGACAA 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1050286331 9:4106156-4106178 TGAGATGGGCCAAAAGGTCAGGG No data
1050286323_1050286327 11 Left 1050286323 9:4106107-4106129 CCTTCCACCAACACCTTAGACAA 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1050286327 9:4106141-4106163 CACTGCTGAATCACTTGAGATGG No data
1050286323_1050286328 12 Left 1050286323 9:4106107-4106129 CCTTCCACCAACACCTTAGACAA 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1050286328 9:4106142-4106164 ACTGCTGAATCACTTGAGATGGG No data
1050286323_1050286329 20 Left 1050286323 9:4106107-4106129 CCTTCCACCAACACCTTAGACAA 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1050286329 9:4106150-4106172 ATCACTTGAGATGGGCCAAAAGG No data
1050286323_1050286330 25 Left 1050286323 9:4106107-4106129 CCTTCCACCAACACCTTAGACAA 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1050286330 9:4106155-4106177 TTGAGATGGGCCAAAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050286323 Original CRISPR TTGTCTAAGGTGTTGGTGGA AGG (reversed) Intronic
900337940 1:2174071-2174093 TTTTCAAAGGTGCAGGTGGAGGG + Intronic
900898163 1:5498275-5498297 GTGTCTAAGGCGTTCGGGGAGGG + Intergenic
902333522 1:15742476-15742498 TGGGCAAAGGTGTCGGTGGAGGG - Exonic
903348288 1:22701926-22701948 TTGACTAAGGAGTTTTTGGAAGG - Intergenic
904428767 1:30448387-30448409 ATAACTAAGGTGTTTGTGGATGG + Intergenic
908426581 1:64013687-64013709 TGGTCAAAGGGGTTGATGGAAGG - Intronic
911256763 1:95642005-95642027 TTGTGGAAAGTGTTGGTGGAAGG + Intergenic
915052422 1:153089533-153089555 TTGTCTTGGTTGTTGGTGTACGG - Intergenic
915521551 1:156447976-156447998 TGGCCTAAGGAGTTGGTGGTGGG + Intergenic
916752381 1:167734792-167734814 TTGCCTCAGATGTGGGTGGATGG + Intronic
921106097 1:211980288-211980310 TTGTCTAAGGTGTGGTTTCAAGG - Intronic
921676923 1:217986787-217986809 TGGTTTAAGGGGTTGGTGGTGGG - Intergenic
923981825 1:239333122-239333144 TTGTCTGAGGTTTGTGTGGAGGG + Intergenic
1068171296 10:53397668-53397690 TTGTCTAGAGTGTTGGCTGATGG - Intergenic
1069862298 10:71479375-71479397 TTGTCTAAGGATTTGGGGGCGGG + Intronic
1072365587 10:94705355-94705377 CTGTCCGGGGTGTTGGTGGAGGG + Intronic
1072429157 10:95355916-95355938 TTGTCTGGGGTGGTGGTGGAGGG + Intronic
1074263291 10:111875408-111875430 TTGTCTGAGGTGTTCTTGGAAGG - Intergenic
1074496824 10:113986873-113986895 TGTTCTTAGGTGTTGGTGGGGGG - Intergenic
1074961929 10:118454767-118454789 TTTTCTAAGGTTCTGGTGTAGGG - Intergenic
1075198062 10:120378369-120378391 TTGGCTAACGTGTTGGGGAAAGG + Intergenic
1075887616 10:125915052-125915074 ATGGCTAATGTGTTGGTGAAAGG + Intronic
1083467047 11:62855231-62855253 TTGTCTGAGGTGTTAGTGAAGGG - Intergenic
1087284278 11:96247866-96247888 TGGTCAGATGTGTTGGTGGAAGG - Intronic
1088223625 11:107594118-107594140 GTGTTTATGGTGGTGGTGGAGGG + Intronic
1089049091 11:115530544-115530566 TTGTCTAAGGTGATTGGGGTAGG - Intergenic
1089987022 11:122824412-122824434 TTGTCTAAGATGTTGCTGTCAGG + Intergenic
1094389166 12:29930427-29930449 GTGTCTATGGTTTTGGTGAAAGG + Intergenic
1095493714 12:42762674-42762696 TTGGCTTAGAGGTTGGTGGAAGG + Intergenic
1097158801 12:57031116-57031138 TTGTCTAAGACGTTTGTGGATGG + Exonic
1100902810 12:99262083-99262105 TTGAAGAAGGTGTTGGAGGAGGG - Intronic
1101845078 12:108357247-108357269 TTGTTGAGGGTGTTGGGGGAAGG - Intergenic
1104867068 12:131962061-131962083 ATTTCTAAGGTGTTGGGGCAAGG + Intronic
1107607168 13:42070729-42070751 TTGTCTAAAGTGCTGGAGCAGGG - Intronic
1108672031 13:52700968-52700990 TTATTTGAGGTGCTGGTGGAAGG + Intergenic
1115819191 14:37195956-37195978 TTGGTTATGGTGGTGGTGGAGGG + Intergenic
1115995636 14:39193012-39193034 TTTTTTAAGTTGTGGGTGGAGGG + Intergenic
1117196121 14:53341636-53341658 TTGTCTGAGATGTGGGTGAAAGG + Intergenic
1119087919 14:71754082-71754104 GCCTCTCAGGTGTTGGTGGAGGG - Intergenic
1119651704 14:76388547-76388569 AAGTTTAAGGTGGTGGTGGAGGG + Intronic
1121720044 14:96102928-96102950 TTGGCTATGGTGGTGGGGGATGG + Intergenic
1122661995 14:103302142-103302164 TTGTCTTTGGTGGTGGTGGCAGG - Intergenic
1123098861 14:105781243-105781265 TTTTCTAATCTGTTGGTGTATGG + Intergenic
1123920043 15:25063763-25063785 TTGTCTCAGAGGTTGGTGCAGGG + Intergenic
1124651255 15:31476025-31476047 TTCTCAAAGGTGATGGTGAATGG + Exonic
1128586370 15:68853940-68853962 TGGTGTAAGGGGTTGGGGGAGGG + Intronic
1129021519 15:72523844-72523866 TTGGCAAATGTGTTGGGGGAGGG + Intronic
1131414760 15:92244961-92244983 AGGACTAAGGGGTTGGTGGAAGG - Intergenic
1132264902 15:100461255-100461277 TAGTCAAAGGAGGTGGTGGAGGG - Intronic
1132986745 16:2771232-2771254 TTGTATAAGGTGTTCTTGGAAGG + Exonic
1135349295 16:21715254-21715276 TTGTCTCAGCTGTTGGTGTCTGG + Intronic
1137281363 16:46979529-46979551 TTATTTAAGGTGTTTGAGGAAGG + Intergenic
1137378244 16:47973491-47973513 TTCTCTAAAGTTTAGGTGGATGG + Intergenic
1139116061 16:63954569-63954591 GTTTCTAAAGTGGTGGTGGATGG - Intergenic
1139579246 16:67862502-67862524 TTGACTGAAGTGGTGGTGGAAGG - Intronic
1142352799 16:89587530-89587552 TTGTTAAATGTGTTTGTGGAAGG - Intronic
1144245110 17:13355383-13355405 TTATCTAGGTTGTTGGTAGATGG + Intergenic
1145289676 17:21533404-21533426 TTTTCTAAGGTTGTGCTGGACGG - Exonic
1146220691 17:31016909-31016931 TTTGCTAAGGTGGTGGTTGATGG + Intergenic
1146430155 17:32785536-32785558 TTGTCTAAGGAGATAGTGAAAGG - Intronic
1150367088 17:64598454-64598476 TTTGCTAAGGTGGTGGTTGATGG - Exonic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1152884513 17:82841720-82841742 TTGTGTCAGGAGTTTGTGGAGGG + Intronic
1153751683 18:8238745-8238767 TGGTGTAAGGTGTGGGGGGAGGG + Intronic
1155726270 18:29088075-29088097 TTGTCAAATGTGGTGGTGGCAGG + Intergenic
1156641237 18:39101990-39102012 TTTTCTAAGATGCTGGTGTAAGG - Intergenic
1156964406 18:43073171-43073193 TTGACTAAGAAGTTGGGGGATGG - Intronic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1160268904 18:77366206-77366228 GTGTCTTACGTGTTTGTGGATGG + Intergenic
1162612160 19:11765246-11765268 TTTGGTCAGGTGTTGGTGGAAGG + Intergenic
1163038282 19:14584259-14584281 TTGCCTAAGGTGTCTGAGGAGGG + Intronic
1163038972 19:14588520-14588542 TTGCCTAAGGTGTCTGAGGAGGG + Intronic
1163184239 19:15626342-15626364 TTGGCTGAGGTGTGGGTAGAGGG - Intronic
1163501951 19:17681395-17681417 TTGTGTGTGATGTTGGTGGAGGG + Intronic
929063145 2:37943908-37943930 TTTTCTTAGGTGGTGGGGGAGGG - Intronic
929205541 2:39288107-39288129 TTGCCTTAGGTAATGGTGGAGGG - Exonic
931075764 2:58709853-58709875 CTGTCTAAGGTGGTGCTGCAGGG + Intergenic
932667580 2:73709326-73709348 TTTTGTAAGGTGCTGGTGCAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932953223 2:76318072-76318094 TCATCTAAGGTGAGGGTGGAAGG + Intergenic
935845659 2:107163224-107163246 ATATCAAAGCTGTTGGTGGATGG + Intergenic
936440887 2:112552010-112552032 TTGTCTAAACTGTTTTTGGAGGG + Intronic
937041018 2:118820709-118820731 TGGTCTGGGGTGATGGTGGAAGG - Intergenic
939443776 2:142282537-142282559 TTGTCAGAGGAGTTTGTGGACGG + Intergenic
941515622 2:166472590-166472612 TTGTCTAATTTATTGGTGGTTGG - Intronic
942918117 2:181337189-181337211 TTGTCTAAGATGTGAGTGAATGG - Intergenic
945379590 2:209123935-209123957 TTGACTTAGGTGGTGATGGAAGG + Intergenic
948818130 2:240523921-240523943 TTGTCGAAGCTGCTGGTGCACGG + Exonic
1169544203 20:6634531-6634553 TTGTGTTAGGTGTTGTTGAATGG - Intergenic
1170147026 20:13186589-13186611 TGGTATAAGGTGTTGGGGAAGGG - Intergenic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1174094606 20:48078316-48078338 TTGTTAAAGGTGTTTGGGGAAGG + Intergenic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1177358660 21:20040655-20040677 CTCTCTAAGGTGTAGGTGAAAGG - Intergenic
1179978066 21:44881964-44881986 TTGTCAAAAGTATAGGTGGAGGG - Intergenic
1182038079 22:27214957-27214979 TTAGCTCAGGTGATGGTGGATGG + Intergenic
951529664 3:23686680-23686702 TGGTCAGAGCTGTTGGTGGAAGG - Intergenic
951997633 3:28748766-28748788 TTCTCTAAGGAGCTGGTAGATGG + Intergenic
952162661 3:30709721-30709743 TTGTCTTACGTGTTGTTGGTGGG - Intergenic
952518901 3:34134823-34134845 TTTTTTATGTTGTTGGTGGAAGG - Intergenic
953632286 3:44629273-44629295 TTGTCTAAAGTGTAGGTGGGAGG - Exonic
953764364 3:45724860-45724882 TTGTATATGGTGTAGGTGTAAGG + Intronic
954131830 3:48564859-48564881 TTGTCTATGGTGGCTGTGGAGGG - Exonic
955433964 3:58879732-58879754 GTGTCTTGGGGGTTGGTGGAGGG + Intronic
955474873 3:59326394-59326416 ATGGCTGAGTTGTTGGTGGAGGG + Intergenic
955479752 3:59377544-59377566 TTGTCAAAGGAATGGGTGGATGG - Intergenic
958061501 3:88488509-88488531 TTATCTAAGGTTTTGGAGTAAGG + Intergenic
960216422 3:115043839-115043861 TGGTCTCCGGTGTTGGAGGAGGG + Intronic
963316691 3:143766538-143766560 TTTTCTTAGCTGTAGGTGGAGGG + Intronic
965350179 3:167601960-167601982 TTGGAAAAGGTGTTGGTTGATGG - Intronic
965884458 3:173427091-173427113 TTTTCTAATTTGTTGGTGTATGG + Intronic
966278551 3:178204506-178204528 TTGTCTAAAATGTTGGTGTCTGG - Intergenic
968220701 3:196937139-196937161 TTGTCTAACATGTTTGTGGGAGG - Intronic
970198024 4:13572432-13572454 TTGCCTTTGGTCTTGGTGGATGG + Intronic
972455607 4:39251329-39251351 TTGTATAAGGTGTAAGGGGAAGG - Intronic
973088445 4:46099632-46099654 TTAACTAAGGTGTTGGTGGTGGG - Intronic
973199955 4:47489155-47489177 TTGTCTAAGGTTAGGGTAGAGGG + Intronic
974417167 4:61623829-61623851 TAGTCTGAGGTGGTGGTGGTGGG + Intronic
974421542 4:61683038-61683060 TTGACTAGGGTGGTGGTGGTGGG + Intronic
975758803 4:77597836-77597858 TTGACTTAGGTGCTGGTGGTGGG - Intronic
978168248 4:105634717-105634739 TTTTCTAAGTTTTTGATGGATGG + Intronic
981316610 4:143346473-143346495 AAGACTAAGGTGCTGGTGGAGGG + Intronic
982488161 4:155994128-155994150 GTGTCTCAGGTGTGGGTGGGGGG + Intergenic
984442326 4:179787988-179788010 TTGTCTGAGCTGCTGGTGGTGGG + Intergenic
989423570 5:41269503-41269525 TTGACTAAGGTGATGGGGAATGG + Intergenic
989718760 5:44498670-44498692 TTGTCAAAGTTGTTTGAGGATGG + Intergenic
994060139 5:95466468-95466490 TTTTCTTAGGTGTGGGTTGAGGG - Intronic
994595791 5:101832862-101832884 TTGACTAAGGTGTTAGTTGTGGG + Intergenic
994803998 5:104419704-104419726 TGGTCAAAGATGTAGGTGGAGGG + Intergenic
995865298 5:116683942-116683964 CTGTCTAAAGTGTTAGGGGAGGG - Intergenic
997045475 5:130311762-130311784 ATTTTTAAGGTATTGGTGGATGG - Intergenic
998175984 5:139902396-139902418 TTTGCTAAGGAGTTGTTGGAGGG + Intronic
998201074 5:140121867-140121889 CTGTTTAATGTGTTTGTGGATGG + Exonic
998389288 5:141776900-141776922 TTGTTTAAGATTTTGCTGGAAGG - Intergenic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999883270 5:155890848-155890870 TTGTCTGGGGTGGTGGTGGTGGG + Intronic
1000894694 5:166841677-166841699 ATGTCTTAAGTGTTGTTGGAAGG + Intergenic
1000913856 5:167056179-167056201 TTGTTTAAGCTGTTGGTTGATGG + Intergenic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1003547173 6:7069279-7069301 TTTTCTAGGGTATAGGTGGAAGG + Intergenic
1003770366 6:9292255-9292277 TTGTCTAATGTGCTGCTGGTGGG + Intergenic
1005089890 6:22045486-22045508 TGGTGTAAGGTGTTGGGTGAAGG + Intergenic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1006988952 6:38196702-38196724 TTGTCTAATGAGTTTGTGGAAGG - Intronic
1008514445 6:52306480-52306502 TTTTTTAAGGTGTTGGGGGTAGG - Intergenic
1008919845 6:56831444-56831466 TTGTGTTATGTGTGGGTGGATGG - Intronic
1012654280 6:101795223-101795245 TTATCTATGGTATTGGTTGAGGG + Intronic
1013468398 6:110438063-110438085 TTGTCTAGGGTGGTCGAGGATGG - Intronic
1013652420 6:112209197-112209219 TTGTCTGAGTTCTTGCTGGACGG + Intronic
1019886694 7:3911727-3911749 CTGTATTAGGTGTTGGAGGAGGG + Intronic
1021386775 7:20040444-20040466 CTGCCTCAGGTGTTGGGGGAAGG - Intergenic
1027443479 7:78245705-78245727 GTGTCCAAGGTGTTGATGGGGGG - Intronic
1031075543 7:117208864-117208886 TTGTCTTTGGTGGTGGTGGTGGG + Intronic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034679793 7:152919916-152919938 TTGTCTCTGGTGTTTGTGGTAGG + Intergenic
1034873209 7:154701855-154701877 TTGTATAAGGTGATGGCAGATGG - Intronic
1037293067 8:17371659-17371681 TTTTCTAAGCTGTTGGTGGTCGG + Intronic
1037389459 8:18378641-18378663 TTGTCCAATTTGTTGGTGAATGG - Intergenic
1039467767 8:37796621-37796643 TTGTGGAAGGTGGTGGTGGTCGG + Intronic
1039892908 8:41696709-41696731 TTGTCTGAGGTCTCGGTGGCCGG + Exonic
1042155360 8:65840302-65840324 TTGCCTAAAGTGTTTGTAGAAGG - Intronic
1042433995 8:68742712-68742734 TTTTCTAAGATGTTGGTGAAAGG - Intronic
1043809496 8:84719061-84719083 TTCTCTAAGCTGCTGGTGGCTGG + Intronic
1044024523 8:87152200-87152222 TTGACTATGGTATTGATGGAGGG + Intronic
1045824978 8:106386629-106386651 TTGACTTAGGGGTTGGAGGAGGG - Intronic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1050867516 9:10521652-10521674 TTGTCGAAGGTTAGGGTGGATGG - Intronic
1056089083 9:83186884-83186906 TTGGCCAAGGTGTTGGTGGGAGG - Intergenic
1059535820 9:115079727-115079749 TTTTCCAAGGTGATGGTGAATGG + Intronic
1060312701 9:122477118-122477140 TTGTCATTGGTGTTGCTGGATGG + Exonic
1186581865 X:10828332-10828354 TGGGGTAGGGTGTTGGTGGATGG + Intronic
1187151287 X:16684152-16684174 TTTTCTAAGGTGTTTGGGGAAGG - Intronic
1187485753 X:19701550-19701572 TTGTGTTAGGTGCTGGAGGAAGG - Intronic
1188453035 X:30329002-30329024 TGGTCTCAGGGGTTGATGGAAGG - Intergenic
1188831437 X:34902666-34902688 TTGGCTAAGGTTTTGGTTAAAGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1195925388 X:110019563-110019585 TTATCAAAGGTTTTGGAGGAAGG - Intronic
1195969991 X:110462725-110462747 TTATTTTAGGTTTTGGTGGAAGG - Intergenic
1196039878 X:111190924-111190946 TTCTTGAAGGTGTTGGTGGGAGG + Intronic
1200371310 X:155727949-155727971 TGGTCTTTGATGTTGGTGGATGG + Intergenic