ID: 1050287024

View in Genome Browser
Species Human (GRCh38)
Location 9:4114127-4114149
Sequence CAGAGTGAGTAGAGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050287024 Original CRISPR CAGAGTGAGTAGAGGGACCC AGG (reversed) Intronic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900791526 1:4684027-4684049 GGGAGTGAGCAGAGGGCCCCGGG + Intronic
902396535 1:16135017-16135039 CTGTGTGAGTTGGGGGACCCTGG - Exonic
903216721 1:21847520-21847542 GAGAGGGAGTGGAGGGACGCTGG + Intronic
903341229 1:22655774-22655796 CAGAGTGGCCACAGGGACCCAGG - Intronic
903654766 1:24942553-24942575 CAGAGGGTTGAGAGGGACCCAGG + Intronic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
904226541 1:29025823-29025845 CAGAGTGAGGAGTGGGTCCGTGG + Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905271025 1:36787505-36787527 CAGAGAGAGGAGAGAGTCCCAGG + Intergenic
905299455 1:36976590-36976612 CAGATTGAGGATTGGGACCCAGG + Intronic
905325404 1:37148258-37148280 CACAGTGAGTTGAGGGTGCCTGG - Intergenic
911832882 1:102576986-102577008 CAAAGTGAGGAGAGGGACTGGGG + Intergenic
912804571 1:112744891-112744913 TGGGGTGAGTAGAGGGACACAGG - Intergenic
915225144 1:154406132-154406154 CAGAGGGAGAAGAGGGGCGCTGG - Intronic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
916786622 1:168091372-168091394 CATATTAAGTAGTGGGACCCTGG + Intronic
916864740 1:168844184-168844206 CAAAGTGAGATGAGGGAACCTGG + Intergenic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
918091143 1:181296227-181296249 CAGAATGAGGAGAGGGGCCCTGG - Intergenic
919664587 1:200279833-200279855 CATAGGGAGTACAGGGAACCTGG - Intergenic
920248778 1:204608256-204608278 CAGAGTGAGAGATGGGACCCTGG + Intergenic
922852983 1:228749853-228749875 CAGAGTAAGCAAAGGAACCCAGG - Intergenic
923050010 1:230384390-230384412 GAGACTGTGTAGAGGGACTCTGG + Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923565963 1:235076105-235076127 GGGAGTGGGTAGAGGGCCCCTGG - Intergenic
1063975626 10:11413436-11413458 CAGAGGGAGTTCAGGGACACAGG - Intergenic
1066056416 10:31685304-31685326 CTGAGTGAGAAGGGGGACACTGG - Intergenic
1069430245 10:68328561-68328583 CATAGAGATCAGAGGGACCCTGG - Intronic
1069879044 10:71580330-71580352 CAGGGTGAGAAGGGAGACCCAGG + Intronic
1070019267 10:72567824-72567846 TAGAGAGACTAGAAGGACCCTGG - Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072249895 10:93573067-93573089 CAGAGAGGGTAGAGCCACCCAGG - Intronic
1072411799 10:95209483-95209505 GAGAGATAGTAAAGGGACCCAGG + Intronic
1075625195 10:123959094-123959116 GAGACTGAGGAGAGGGACCTTGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077414381 11:2418001-2418023 CACAGGGAGCAGAGAGACCCAGG - Intronic
1079358517 11:19750734-19750756 CAGAGTCAGAATAGGGTCCCAGG + Intronic
1081840518 11:46197817-46197839 CAGAGTGTGGTGTGGGACCCAGG + Intergenic
1081995186 11:47359395-47359417 ATGAGTGAGTGGAGGGACCCTGG + Intronic
1083369336 11:62165974-62165996 CAGATTGAGGAGAGTGACTCGGG + Intergenic
1083583951 11:63842880-63842902 CAGAGTGATTAAAGGGCTCCTGG - Intronic
1084201006 11:67558328-67558350 CAGAGAGAGCAGGGGGAGCCTGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084617719 11:70247504-70247526 CAGAGTGGGGAGAGGGCCCCTGG - Intergenic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085402042 11:76241249-76241271 GGCAGTGAGTAGAGGGAGCCTGG - Intergenic
1086052172 11:82606048-82606070 CACAGTAAGTAGAAGGACTCAGG - Intergenic
1086914502 11:92513245-92513267 AGGAGTGAGTGGAGTGACCCTGG + Intronic
1089003979 11:115075336-115075358 CAAAGTGAGAAGAGGGTCTCAGG + Intergenic
1090660628 11:128879414-128879436 CAGAAAGAGTGCAGGGACCCTGG - Intergenic
1090854960 11:130603076-130603098 CAGAGGAACTGGAGGGACCCTGG + Intergenic
1094422717 12:30288697-30288719 AAAAGTGAGAAGAGGGACCAAGG - Intergenic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1097712834 12:62934473-62934495 CAGAGTGAGTGCAGCGACACCGG - Exonic
1102786535 12:115609587-115609609 CAGAGTGAGAGCAGGGATCCAGG + Intergenic
1103915378 12:124373196-124373218 CAGTGTGAGTACAGGGGACCCGG + Intronic
1104409142 12:128543634-128543656 CTGAGTGAGGAGACGGACCCAGG + Intronic
1108002282 13:45915311-45915333 CAGAGTGGGTACAGGGAGCAGGG - Intergenic
1110860200 13:80339444-80339466 CGGAGTGAGCAGTGGGACCCTGG - Exonic
1113395145 13:109940561-109940583 AAGAGGGAGTTGAGGGCCCCAGG - Intergenic
1114617281 14:24075097-24075119 CACGGTGAGTAGGGGGACTCGGG - Intronic
1118003309 14:61543483-61543505 CAGAGTGAGTGAGGGGACCAGGG - Intronic
1118029396 14:61805650-61805672 GAGAGAGAGAACAGGGACCCAGG - Intergenic
1121403212 14:93701078-93701100 CTGAGTGAGGAGAGGTAGCCAGG - Intronic
1122027865 14:98890707-98890729 CCCAGTGAATAAAGGGACCCGGG + Intergenic
1122179206 14:99943483-99943505 CCGAGTGAGTATGGGGACTCCGG + Intergenic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122409575 14:101518967-101518989 CAGAGGGAGCAGAGGATCCCAGG + Intergenic
1124693616 15:31845709-31845731 CAGAGTGGGTAGAGGGTACAGGG - Intronic
1124865510 15:33486874-33486896 CAGAGTGAGAAGTGGTGCCCAGG + Intronic
1126348067 15:47717400-47717422 CCGAGTGCGTGGAGGGAGCCAGG + Intronic
1127318023 15:57815892-57815914 CAGAGTGAGTGGCGGAAGCCAGG + Intergenic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1132395998 15:101474842-101474864 CAGAGGGTGTTGAGGTACCCGGG - Intronic
1132525955 16:414857-414879 CAGAGCCTGTGGAGGGACCCAGG - Intergenic
1132613548 16:829304-829326 CAGAGAGATTCGAGGGGCCCCGG + Intergenic
1133777246 16:8906407-8906429 CAAAGTAAGTGGTGGGACCCAGG - Exonic
1134466504 16:14483478-14483500 CAGAGTAATAAGAAGGACCCTGG - Intronic
1134559481 16:15195847-15195869 CAGAGTGATTTGGGGGACCAGGG - Intergenic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1134920020 16:18107458-18107480 CAGAGTGATTTGGGGGACCAGGG - Intergenic
1135985176 16:27178800-27178822 GAGAGGGAGTAGTGGGATCCTGG - Intergenic
1136540759 16:30926577-30926599 CAGAGTGGGGAGGGGGACGCAGG - Intronic
1136867472 16:33769123-33769145 CAGAGTGCGGACAGTGACCCAGG - Intergenic
1138154163 16:54686998-54687020 CATAGTGACTAGTGGGATCCAGG + Intergenic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1141355005 16:83337249-83337271 GAAAGAGAGTAGAGGAACCCAGG + Intronic
1141760319 16:86024880-86024902 CAGAGTGGGGATTGGGACCCAGG + Intergenic
1203104686 16_KI270728v1_random:1347080-1347102 CAGAGTGCGGACAGTGACCCAGG + Intergenic
1203128828 16_KI270728v1_random:1615288-1615310 CAGAGTGCGGACAGTGACCCAGG - Intergenic
1142843887 17:2656462-2656484 AAGAGTGAGGAAAGGGGCCCGGG + Intronic
1143982062 17:10878725-10878747 CAGATTTAGTAGCAGGACCCTGG + Intergenic
1144625502 17:16842429-16842451 CTGACTGAGGAGAGGGATCCAGG - Intergenic
1144880927 17:18430292-18430314 CTGACTGAGGAGAGGGATCCAGG + Intergenic
1144966360 17:19079118-19079140 CAGAGTGACTTGAAGGGCCCAGG + Intergenic
1144981558 17:19172939-19172961 CAGAGTGACTTGAAGGGCCCAGG - Intergenic
1144986666 17:19205300-19205322 CAGAGTGACTTGAAGGGCCCAGG + Intergenic
1145151305 17:20514095-20514117 CTGACTGAGGAGAGGGATCCAGG - Intergenic
1146631671 17:34474416-34474438 CAGAGAGAGGAGCGGGACCCAGG + Intergenic
1146711096 17:35042080-35042102 CAGAGAGAGGAGAGAGACCTTGG - Intronic
1147446400 17:40477748-40477770 CTGAGTGAGGGGTGGGACCCAGG + Intronic
1151138934 17:71973363-71973385 TATAGTGAGTAGAGGGAACGGGG - Intergenic
1151430162 17:74056823-74056845 AAGAGAGAGGAGAGGGAGCCAGG - Intergenic
1151658786 17:75508012-75508034 CTGAGTGAGGGGAGGGGCCCTGG - Intronic
1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG + Intronic
1152342054 17:79730844-79730866 CAGAGTGGGGACAGTGACCCAGG - Intergenic
1152561764 17:81082143-81082165 CAGAGTGGGTAGCGGCATCCAGG + Intronic
1153747369 18:8193695-8193717 CAGAAAGTGTTGAGGGACCCAGG + Intronic
1155147558 18:23096768-23096790 CTCAGTGAGTGGAGGGAACCAGG + Intergenic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1157550287 18:48576469-48576491 CAGAGTGGCAAGTGGGACCCAGG - Intronic
1159881822 18:73865342-73865364 GAGAGTGAGAAGAGGGTCCAAGG + Intergenic
1160372204 18:78383194-78383216 CAGAGTGAGTAGAGAGGACCTGG - Intergenic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1162017473 19:7853330-7853352 CAAAGTGAGTCCAGGGGCCCAGG + Exonic
1162721526 19:12665646-12665668 CAGAGGGATTACAGGGACCATGG + Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1164376863 19:27694955-27694977 TAGAGTGACTAGAGTGAACCTGG + Intergenic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1165734914 19:38169947-38169969 CAGGGTGAGATGAGGGGCCCAGG + Intronic
1166325245 19:42045963-42045985 CAGAGAGAGACGAGGGACCCAGG + Intronic
1166369428 19:42292883-42292905 CAGAGTGAGTTGGGGGACCCAGG + Intronic
1167129241 19:47573382-47573404 GAGAGTGAGAAGAGTGAGCCGGG + Intergenic
1167311412 19:48739744-48739766 CAGAGGGAGGACAGGGACCCAGG + Intronic
1168103243 19:54152317-54152339 CCGAGCGAGGTGAGGGACCCAGG + Exonic
925969801 2:9098428-9098450 CACAGGGAAAAGAGGGACCCAGG + Intergenic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
932426819 2:71643041-71643063 CAGAGTGAGTGATGGGACCTTGG + Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933778585 2:85786614-85786636 CACAGTGGGTAGTGGGAGCCAGG - Intronic
935568713 2:104636388-104636410 CAAAGTGATAAGAAGGACCCAGG - Intergenic
935881299 2:107568770-107568792 CAGAGTGTGTGCAGGGACCTAGG + Intergenic
936235875 2:110742072-110742094 CACGGTGAGGAGAGGGTCCCAGG + Intronic
937612209 2:123875759-123875781 TAGAGTGAGCAGAGGGATCTGGG + Intergenic
940525197 2:154805343-154805365 CAGAGGGAGTAGAAGAACGCCGG + Intronic
941911182 2:170766148-170766170 CAAAGACAGTAGAGGGAGCCTGG - Intergenic
945977820 2:216284257-216284279 AAGGGTGACTGGAGGGACCCAGG - Intronic
946227269 2:218270599-218270621 CGGGGTAAGGAGAGGGACCCCGG + Exonic
946332474 2:219018185-219018207 CAGACTTAGGAGAGGGATCCAGG - Intronic
946390004 2:219409414-219409436 AAGAGAGAGAAGAGGGGCCCTGG + Intergenic
948729125 2:239952291-239952313 CAGAGTGGGGAGGGGGGCCCAGG + Intronic
1168806092 20:673130-673152 CATAGTGAGGACAGGCACCCTGG - Intronic
1170196532 20:13694643-13694665 CAGTGTGACTAGAGGGACTTGGG - Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1172702284 20:36861081-36861103 CAGAGTGAGTAGCAGGAACCGGG + Intronic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1174182897 20:48686265-48686287 AAGATTCAGTAGCGGGACCCTGG + Intronic
1174820633 20:53723908-53723930 CAGAGTGAGCAGAGGTAGCCTGG + Intergenic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175708237 20:61197278-61197300 GAGAGAGTGCAGAGGGACCCCGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1177964924 21:27715924-27715946 TTGAGAGAGGAGAGGGACCCAGG - Intergenic
1178293475 21:31388678-31388700 CAGAGAAAGTGGAGGGAGCCAGG + Intronic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181387588 22:22557449-22557471 CAGAGAGAAAACAGGGACCCGGG + Exonic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1181603309 22:23965084-23965106 CACAGTGAGGAGAGAGACCGAGG - Intergenic
1181605205 22:23976223-23976245 CACAGTGAGGAGAGAGACCGAGG + Intronic
1181799279 22:25333869-25333891 CAGGGTGGATAGAGGAACCCTGG + Intergenic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182477026 22:30581919-30581941 AAGAGTGAGAAAAGGGACCCTGG + Intronic
1183656670 22:39189669-39189691 CAGAGTGGTTTGAGGGCCCCTGG + Intergenic
1184445432 22:44544381-44544403 CTGAGTGAGAGCAGGGACCCTGG - Intergenic
1185195728 22:49468141-49468163 CAGAGAGAGGAGAGGAACCCTGG + Intronic
953358777 3:42276953-42276975 CAGAGTGGGTGGAGGGGCCCTGG + Intergenic
955236595 3:57144808-57144830 GAGAGTGGGGAGAAGGACCCTGG - Intronic
956007675 3:64798140-64798162 CAGACCAAGTAGAAGGACCCAGG - Intergenic
956863685 3:73349057-73349079 CTGAGTGACATGAGGGACCCTGG + Intergenic
957108599 3:75924319-75924341 CAGAGTGAGTAGAGGAGCTTGGG + Intronic
958537248 3:95419011-95419033 CAGAGAGAGGACAGGGACCCTGG - Intergenic
961445205 3:126977303-126977325 CAGAGTGAGTAGGTGGAACTGGG - Intergenic
962399595 3:135047012-135047034 TGGAGAGAGTAGAGGGACCCAGG + Intronic
964442662 3:156728208-156728230 CAGAGGCAGTAGAGCCACCCAGG + Intergenic
965358377 3:167706968-167706990 AAGAGTGAGTACAGGGAGTCAGG - Intronic
965694848 3:171397300-171397322 CAGAGTGAGGTGACGGACCAAGG + Intronic
967372419 3:188761954-188761976 CAGAGTGTGTAGAGGCACCCAGG + Intronic
968801078 4:2743606-2743628 CAGGGTGTGAACAGGGACCCTGG - Intronic
969662526 4:8538547-8538569 CAGAGTGAGAGCAGGGCCCCAGG + Intergenic
973047570 4:45553549-45553571 CTGAGGGACTAGATGGACCCAGG + Intergenic
974884421 4:67800368-67800390 AAGAGTGTGTAGACAGACCCTGG - Intergenic
977767415 4:100815989-100816011 CAGAGTTAGTAGATGGATCTGGG + Intronic
978219813 4:106256507-106256529 CAGAGTGTGTACAGGGAGCCGGG + Intronic
979023164 4:115528677-115528699 CAGATAGAGTAGATGGACCTGGG + Intergenic
981665582 4:147222319-147222341 CAGATTGAGTAGTGTGATCCAGG + Intergenic
982626630 4:157775472-157775494 CAGAGTGAGTAGGTTGAACCTGG - Intergenic
985820177 5:2154248-2154270 CCACGTGAGTGGAGGGACCCCGG + Intergenic
986004202 5:3654410-3654432 CAGAGTGGGGAGAGGGACTTTGG + Intergenic
987543968 5:19288581-19288603 CACAGTGTGGAAAGGGACCCGGG - Intergenic
988069370 5:26267023-26267045 CAGGATGAGTAGGGTGACCCAGG + Intergenic
990434327 5:55772710-55772732 CAGAGGAAGTAGAGGGTACCAGG - Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
996686098 5:126282639-126282661 CAGATTGAAAAGAGGGACCTTGG + Intergenic
996754371 5:126920634-126920656 CAGAGTAAATAATGGGACCCAGG + Intronic
997561059 5:134846329-134846351 CGGAGTGAGAGGAGGGGCCCCGG + Intronic
999705567 5:154269717-154269739 CAGTGTCAGTGGAGGGAGCCTGG + Intronic
1001256607 5:170188151-170188173 CAGACTGAGAAGAGGTACCGCGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002163131 5:177328515-177328537 CAGAGGGTGCAGAAGGACCCAGG + Intergenic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006296235 6:33171305-33171327 CAGGGTGAGGTGGGGGACCCCGG - Exonic
1006575779 6:35044517-35044539 CAAAGTGAGGAGAGGGAACAGGG - Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1010874156 6:81080615-81080637 CAGTGTGAGTTGGGGGGCCCAGG + Intergenic
1013191823 6:107810199-107810221 CAGAGTGAGAAGAGCGAGCCTGG - Intronic
1013343859 6:109240598-109240620 CAGAGTGGGTAGAGGGTCAGAGG - Intergenic
1015137517 6:129890571-129890593 CAGAGTGAGCAGGGAGAGCCAGG + Intergenic
1015188108 6:130441625-130441647 CAGTTAGAGTGGAGGGACCCCGG - Exonic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018171382 6:161146013-161146035 CAGAACAAGTAGGGGGACCCTGG + Intronic
1018855806 6:167674052-167674074 CAGAATGAGGACAGGGACCATGG - Intergenic
1019312465 7:369446-369468 CAGGGTGCGTGGTGGGACCCAGG - Intergenic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1021934337 7:25615125-25615147 CAGAGGGAGGAGAGGGCCCTTGG - Intergenic
1022180788 7:27917306-27917328 GAGAGTGAGGAGAGGCACGCTGG - Intronic
1028493316 7:91438270-91438292 CAAAGTGAGAAGAGGGGGCCTGG + Intergenic
1031402716 7:121344865-121344887 AAGAGTGAGTAGGGGCACCAAGG - Intergenic
1032719127 7:134536594-134536616 TAGAGGGACTACAGGGACCCTGG - Intronic
1032724097 7:134575364-134575386 TAGAGGGACTACAGGGACCCTGG - Intronic
1033260827 7:139842703-139842725 CAGAGAGAGTCGAGGGCTCCAGG - Intronic
1033279746 7:139997203-139997225 CGGAGTAAATAGAGGGAACCAGG + Intronic
1034978892 7:155463364-155463386 GAGGGTGAGGAGAGGGAGCCGGG - Exonic
1035521830 8:280737-280759 CAGCGTCAGTAGAGTGGCCCTGG + Intergenic
1036046012 8:5141445-5141467 CAGAGTGGGTAAAGGAATCCTGG - Intergenic
1036129807 8:6098563-6098585 CAGAGAGAGCAGAAGCACCCAGG - Intergenic
1037381350 8:18288280-18288302 GAGAGTGAGAGGAGAGACCCTGG - Intergenic
1038689252 8:29746325-29746347 CAGGGTGACTACAGTGACCCAGG - Intergenic
1038699377 8:29835595-29835617 CAGAGTGAGGTGATGGGCCCTGG - Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040487066 8:47883818-47883840 CAGAGGGCGTAGCGGGACACAGG - Intronic
1040956910 8:52989044-52989066 CAGAGTGAGTAGAAAGGCCCAGG + Intergenic
1046350180 8:112999095-112999117 CTGAGTGAGTAGAGGAGTCCAGG - Intronic
1047343005 8:124000908-124000930 TAGAGAGGGCAGAGGGACCCAGG + Intronic
1048292740 8:133192890-133192912 CAGAGCGTGTGGAGGGACCCAGG + Intronic
1048331011 8:133470843-133470865 CAGGGTGAGGTGAGGCACCCAGG - Intronic
1049184586 8:141243072-141243094 GACAGTGTGTGGAGGGACCCCGG - Intronic
1049255200 8:141610044-141610066 CCCAGTGAGCACAGGGACCCGGG + Intergenic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049720159 8:144111934-144111956 CAGAGTGGAGAGAGAGACCCGGG + Exonic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1053144316 9:35702088-35702110 CAGAGTGCGGACAGGGAACCAGG + Intronic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1056048480 9:82743752-82743774 GAGAGGAAGTAGAGGGTCCCAGG + Intergenic
1057204445 9:93162962-93162984 CACAGTGAGGACAGGGACCTTGG + Intergenic
1057694018 9:97310951-97310973 CAGAGTGTCTAGAGGGAGCTGGG - Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1060278912 9:122202875-122202897 CAGAGTGTGTTGGGTGACCCTGG + Exonic
1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG + Intergenic
1060600057 9:124871231-124871253 CAGATGGAGTAGAAGGAACCCGG + Intronic
1061164245 9:128913235-128913257 CAGAGTGAGGAGAGAGACAGCGG + Intronic
1062546354 9:137065292-137065314 CAGAGAGCCTAGAGGGTCCCAGG + Intronic
1062600467 9:137316710-137316732 CAGAGTGGGGCGAGGGCCCCGGG + Intronic
1185499359 X:585182-585204 CAGAGGGTGGAGAGGGACTCAGG + Intergenic
1190221532 X:48515288-48515310 CAGACTGAGAAGAGGGATCGAGG + Intronic
1192082475 X:68061575-68061597 CATAGTGAGAAGAGGGACAGGGG + Intronic
1193888775 X:87017268-87017290 CAGAGGGAGATGAGGAACCCTGG - Intergenic
1197620196 X:128739277-128739299 CAGAGTCAGGACAGGGACCCAGG - Intergenic
1197863008 X:130990044-130990066 AAGTGTGAGTAGAGGGTGCCGGG - Intergenic
1200138804 X:153887186-153887208 GAGACTGAGTCGAGGGCCCCTGG - Intronic
1201160380 Y:11160591-11160613 GAGAGTGAGAAGAGGTTCCCAGG - Intergenic