ID: 1050288661

View in Genome Browser
Species Human (GRCh38)
Location 9:4130727-4130749
Sequence GAACCACTTCTAGGGAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050288651_1050288661 16 Left 1050288651 9:4130688-4130710 CCAGACAGAAGCCTGCTGCAGGG 0: 9
1: 137
2: 580
3: 1647
4: 2224
Right 1050288661 9:4130727-4130749 GAACCACTTCTAGGGAGGCGTGG No data
1050288649_1050288661 25 Left 1050288649 9:4130679-4130701 CCTGGATGTCCAGACAGAAGCCT 0: 12
1: 67
2: 514
3: 1388
4: 2086
Right 1050288661 9:4130727-4130749 GAACCACTTCTAGGGAGGCGTGG No data
1050288655_1050288661 5 Left 1050288655 9:4130699-4130721 CCTGCTGCAGGGGTAGAGGCCAC 0: 1
1: 2
2: 7
3: 119
4: 446
Right 1050288661 9:4130727-4130749 GAACCACTTCTAGGGAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050288661 Original CRISPR GAACCACTTCTAGGGAGGCG TGG Intronic
No off target data available for this crispr