ID: 1050288872

View in Genome Browser
Species Human (GRCh38)
Location 9:4132685-4132707
Sequence CCAACCATTCATTATAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050288869_1050288872 -3 Left 1050288869 9:4132665-4132687 CCATGAAGATGCACACCAAACCA 0: 1
1: 0
2: 0
3: 24
4: 179
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288863_1050288872 20 Left 1050288863 9:4132642-4132664 CCCCCATGGAGCCCACAGTCTAG 0: 1
1: 1
2: 27
3: 177
4: 887
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288865_1050288872 18 Left 1050288865 9:4132644-4132666 CCCATGGAGCCCACAGTCTAGCC 0: 1
1: 1
2: 0
3: 23
4: 172
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288862_1050288872 25 Left 1050288862 9:4132637-4132659 CCAGTCCCCCATGGAGCCCACAG 0: 1
1: 0
2: 6
3: 52
4: 436
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288867_1050288872 9 Left 1050288867 9:4132653-4132675 CCCACAGTCTAGCCATGAAGATG 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288868_1050288872 8 Left 1050288868 9:4132654-4132676 CCACAGTCTAGCCATGAAGATGC 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288861_1050288872 26 Left 1050288861 9:4132636-4132658 CCCAGTCCCCCATGGAGCCCACA 0: 1
1: 0
2: 4
3: 27
4: 234
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288866_1050288872 17 Left 1050288866 9:4132645-4132667 CCATGGAGCCCACAGTCTAGCCA 0: 1
1: 0
2: 5
3: 24
4: 206
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data
1050288864_1050288872 19 Left 1050288864 9:4132643-4132665 CCCCATGGAGCCCACAGTCTAGC 0: 2
1: 3
2: 35
3: 216
4: 1041
Right 1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050288872 Original CRISPR CCAACCATTCATTATAAAAG AGG Intronic
No off target data available for this crispr