ID: 1050290161

View in Genome Browser
Species Human (GRCh38)
Location 9:4145730-4145752
Sequence GAGGGGGAACAAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2726
Summary {0: 1, 1: 1, 2: 11, 3: 262, 4: 2451}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050290161 Original CRISPR GAGGGGGAACAAAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr