ID: 1050291839

View in Genome Browser
Species Human (GRCh38)
Location 9:4163222-4163244
Sequence GCATGTGCACGCATGTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050291837_1050291839 8 Left 1050291837 9:4163191-4163213 CCATAGCTGCTGCCTCATTTTTT 0: 1
1: 0
2: 5
3: 61
4: 644
Right 1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG No data
1050291838_1050291839 -4 Left 1050291838 9:4163203-4163225 CCTCATTTTTTATGTCTCAGCAT 0: 1
1: 0
2: 2
3: 25
4: 352
Right 1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG No data
1050291836_1050291839 15 Left 1050291836 9:4163184-4163206 CCTGGGTCCATAGCTGCTGCCTC 0: 1
1: 0
2: 1
3: 44
4: 305
Right 1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050291839 Original CRISPR GCATGTGCACGCATGTGCAC TGG Intronic
No off target data available for this crispr