ID: 1050296963

View in Genome Browser
Species Human (GRCh38)
Location 9:4215212-4215234
Sequence CTTTCAGAGGGGAGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050296963_1050296971 22 Left 1050296963 9:4215212-4215234 CCTTCCAACCTCCCCTCTGAAAG 0: 1
1: 0
2: 0
3: 25
4: 312
Right 1050296971 9:4215257-4215279 ACATCCACATGCACCGTTATTGG No data
1050296963_1050296969 -6 Left 1050296963 9:4215212-4215234 CCTTCCAACCTCCCCTCTGAAAG 0: 1
1: 0
2: 0
3: 25
4: 312
Right 1050296969 9:4215229-4215251 TGAAAGTCTCCAATTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050296963 Original CRISPR CTTTCAGAGGGGAGGTTGGA AGG (reversed) Intronic
901707852 1:11089719-11089741 CTTTGGGAGGGCAGGTTGGGAGG + Intronic
903774186 1:25782352-25782374 CTCTCAGAGGTGTGGGTGGAAGG + Intronic
905140318 1:35838428-35838450 CTTTCAGAGGCCAAGGTGGAAGG - Intronic
906474321 1:46157831-46157853 CTTTCAGAAGGGAAGATAGAAGG - Intronic
908092259 1:60698665-60698687 CTTTTATTGGGGAGGTTAGAAGG + Intergenic
908117093 1:60950995-60951017 CTTTCAGAAGGGGGGTGGGTAGG - Intronic
908180211 1:61596416-61596438 CTTTCAGAGGAAGGCTTGGAGGG + Intergenic
909102234 1:71362735-71362757 CTTACAGAAGGAAGGTTGGGTGG + Intergenic
909865113 1:80658674-80658696 CTTTCAGAGGTGAGATTAGATGG - Intergenic
910107227 1:83644711-83644733 ATTTCAGGGGGGAGGTTTAAGGG + Intergenic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
913169919 1:116222493-116222515 CTTCCAGAGGGTAGGATGCAGGG - Intergenic
913187609 1:116383660-116383682 CTTTCAGTAGGGAAGATGGAAGG + Intronic
919448383 1:197738926-197738948 CTTCCTGAGATGAGGTTGGAAGG + Intronic
919911334 1:202112863-202112885 CTTTCAGGGGGCCGGTTGGGTGG - Intergenic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920389082 1:205587693-205587715 CTGACAGAGGGGAGGTGGGATGG + Intronic
920572240 1:207025998-207026020 CTTCCACAGAGGAGGTTGAAGGG + Intronic
922110965 1:222554827-222554849 TTTTATGAGGGGAGGTGGGAAGG + Intergenic
922620938 1:226987726-226987748 CTGTAAGAAGGGAGGTGGGAGGG + Intergenic
922963093 1:229664805-229664827 CTTTCAGAGGGCAGTTTTGATGG - Intergenic
924702324 1:246466521-246466543 CCTTGAGGGTGGAGGTTGGAAGG + Intronic
1064546587 10:16456625-16456647 CTTTCAGTGGAGAGAATGGAAGG - Intronic
1064962286 10:20978511-20978533 CTTTCAGAGGCCAAGGTGGAAGG + Intronic
1065430205 10:25646213-25646235 CTTTGAGAGGCGAGGGTGGGAGG - Intergenic
1065809874 10:29431478-29431500 CTTTCAGAGGTCAGGGTGGCAGG - Intergenic
1066406504 10:35124336-35124358 CTTTCAGAGGCTAAGGTGGAAGG + Intergenic
1066499369 10:35974860-35974882 ACTTCACAGGGGAGTTTGGAAGG + Intergenic
1067214564 10:44291890-44291912 TTTTCAGAGAGGAGGGTGGAAGG - Intergenic
1067828561 10:49596980-49597002 CTTTGAGAGGGGAACCTGGACGG - Intergenic
1069707151 10:70466023-70466045 CTGTCACCGGGGAGGCTGGAGGG + Intergenic
1070545876 10:77452123-77452145 CTTCCAGAGGCCAGGTGGGAGGG - Intronic
1070562178 10:77576276-77576298 CTCTCAGAGTGGAGGTTTCAAGG - Intronic
1070669999 10:78371081-78371103 CTTTGGGTGGTGAGGTTGGAAGG + Intergenic
1070805573 10:79268815-79268837 GTTGCAGAGGGCAGGTTGGCAGG + Intronic
1072339143 10:94429664-94429686 ATAACAGAGGGGAAGTTGGATGG - Intronic
1072439254 10:95439324-95439346 CTCTCAGGTGGGGGGTTGGAAGG - Intronic
1072811970 10:98468912-98468934 CCCTCAGAGGGTAGGATGGAGGG - Intronic
1073092952 10:100959017-100959039 CTTTCAAAGGGAAGCTGGGAAGG + Intronic
1073116640 10:101095259-101095281 CTTGGAGATGGGAGGATGGAAGG - Intronic
1073817042 10:107218937-107218959 CTTTCAGAGGCCAAGTTGGGAGG + Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076481456 10:130787829-130787851 CCTTCAGGGGGGAGGTGGGCAGG - Intergenic
1076720385 10:132389830-132389852 CTCTCCGAGGTGTGGTTGGAGGG - Intergenic
1077388655 11:2288695-2288717 CTTACAGAGGGGAAGTGGGATGG - Intergenic
1079298364 11:19254978-19255000 TTAGCAGAGGGGAGGTTGGGTGG - Intergenic
1080857337 11:36123659-36123681 CTTTCACAGTGAAGTTTGGAGGG + Intronic
1083035169 11:59630226-59630248 CTTTGAGAGGCCAGGTTGGGAGG + Intergenic
1083207365 11:61160941-61160963 GTGGCAGAGGGGAGGTTGGAGGG - Intronic
1083824367 11:65190066-65190088 CTTTCAGAGGTGAGGGAGAATGG - Intronic
1084088236 11:66864552-66864574 CTTCCAGAAGGGAGGATGGGAGG + Intronic
1084703214 11:70801147-70801169 CCTGGAGAGGGGAGTTTGGAAGG - Intronic
1085042242 11:73333496-73333518 CTTCCAGAGGCTAGGGTGGAGGG + Intronic
1085733657 11:79020555-79020577 CTTTCAGAGGTGGGATGGGAAGG - Intronic
1085738785 11:79062202-79062224 CTTTCAGAGGCTGGGGTGGATGG - Intronic
1086110444 11:83193382-83193404 CTTTCTCAGTGGTGGTTGGAAGG - Intergenic
1087835828 11:102873783-102873805 CTTTGAGAGGCCAGGGTGGAAGG + Intronic
1088791977 11:113234182-113234204 ATTTCAGAGGGAAGTTAGGAAGG - Intronic
1089049127 11:115530857-115530879 ATAGCAGAGAGGAGGTTGGAGGG - Intergenic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1089605302 11:119638129-119638151 CTTACCGAGGGGTGGTAGGAGGG + Intronic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1091274087 11:134338402-134338424 GTTTCAGAGGGGATCTTGCAGGG - Intronic
1091692296 12:2605446-2605468 CTGTAAGATGGGAGGTTGGCAGG + Intronic
1092187335 12:6490521-6490543 TTTTCAGAGGGGTGGCTGGAAGG - Intergenic
1092387047 12:8043846-8043868 CTTTCAGAGGCAAAGGTGGAAGG + Intronic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1093846394 12:23977223-23977245 GTTTCAGAGAGGAGGTAGTAAGG + Intergenic
1093937767 12:25019469-25019491 CTGTCAGAGAGGAGTTTGGCTGG - Intergenic
1096674282 12:53218231-53218253 CTTTCAGAGGGAAGGGTGCTTGG - Intronic
1096935795 12:55273740-55273762 CTTTCACAGTGCATGTTGGATGG + Intergenic
1098057897 12:66527801-66527823 ATTTGAGGGTGGAGGTTGGAGGG + Intronic
1098897707 12:76083236-76083258 TTTTAAGATGGGAGGTGGGATGG - Intronic
1100093912 12:91007883-91007905 CTTTCAAAGTGGTGGTTGGTTGG + Intergenic
1101273577 12:103174599-103174621 TTTTCAGAGGGAACGTTGGTTGG - Intergenic
1101649805 12:106667200-106667222 CTTTCACATGGAAGGTTAGAGGG + Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103009269 12:117445536-117445558 CTTTGAGAGGTCAGGTTGGGTGG + Intronic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1103968734 12:124656194-124656216 CTTACAGAGGGGAAGTTTCAGGG + Intergenic
1104318271 12:127724329-127724351 CTCTAAGAGGGAAGGTGGGAGGG + Intergenic
1104355933 12:128087250-128087272 TTTTCAGAGGGAGTGTTGGAAGG - Intergenic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1105871971 13:24513023-24513045 CTTTGAGAGAGGTGGGTGGATGG + Intergenic
1107944599 13:45406667-45406689 CTTGAAGAGGGGAGTTTTGAGGG - Intronic
1108419835 13:50237416-50237438 CTCCCTGAGGGGAGGTTTGAAGG + Intronic
1108481868 13:50880997-50881019 CTTGCAGAGTGGAGGATAGATGG + Intergenic
1109948238 13:69466471-69466493 CTGTCAGAGGGTAGGGGGGAAGG - Intergenic
1110832794 13:80050918-80050940 CTTTGAGAGGTGAGAATGGAAGG - Intergenic
1111584406 13:90265650-90265672 GATTCAGACTGGAGGTTGGATGG - Intergenic
1112159961 13:96856771-96856793 ATTTCAGAGTGGAAGATGGAGGG - Intergenic
1113323102 13:109256379-109256401 CTATCAGAGGGGAGACTGGGAGG + Intergenic
1113452467 13:110420960-110420982 CTCTCAGCGGGGAAGCTGGATGG + Intronic
1113505982 13:110816233-110816255 CTTTCCAAGGGGTTGTTGGAAGG - Intergenic
1113609136 13:111630953-111630975 CTTACACTTGGGAGGTTGGAGGG + Intronic
1115069818 14:29307507-29307529 ATTTCTGAGGAGAGGTGGGAAGG + Intergenic
1116101153 14:40438364-40438386 TTTGCAGAGTGGAGGTTGGGAGG + Intergenic
1117345627 14:54829220-54829242 CTTTAAGAGAGGAGGTGGGAGGG - Intergenic
1117483632 14:56172545-56172567 CTTAAGGAGGGGAGGTTGGTTGG + Intronic
1119163087 14:72469577-72469599 CTTCCAGTGGGGAGCTGGGAAGG - Intronic
1124116509 15:26848287-26848309 CATTCAGACGTGAGGTTGTATGG - Intronic
1124424908 15:29555731-29555753 CTCTCAGAGGGGAGTTAGGGAGG - Intronic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1127664911 15:61136195-61136217 CTTTCAGATGGGAGGGTGGGTGG - Intronic
1128071630 15:64800669-64800691 CTTTCAGAGGCCAAGGTGGAAGG - Intergenic
1128784805 15:70386951-70386973 ATTTCAGAGGGGGGCGTGGAAGG + Intergenic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1131395832 15:92085205-92085227 CCTTCAGAGGGCAGGTGGGGTGG - Intronic
1133848132 16:9476308-9476330 CTTTCAGAGGCCAAGGTGGATGG + Intergenic
1136139069 16:28277124-28277146 CTTGCAGAGGAGAGGGTCGAAGG + Intergenic
1136422018 16:30140682-30140704 CTTTCAGAGGCCAAGGTGGATGG + Intergenic
1137382158 16:48009480-48009502 CTTTCAGAAGGGATGATGGGAGG + Intergenic
1138281389 16:55774462-55774484 CTGACAGAGGGGACGTTGGGAGG + Intergenic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1140923442 16:79560811-79560833 CCTTCACAGGGGAGTTGGGAGGG - Intergenic
1142171357 16:88624382-88624404 CTGTTAGAGGGGAGCCTGGAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1145912003 17:28548359-28548381 CCTGCAGAGGGCAGGTTGGCAGG + Intronic
1146091952 17:29888236-29888258 CTTTCTGGGGGTAGGGTGGATGG - Intronic
1146616108 17:34358654-34358676 CTCTCAGAGGTGTGGGTGGATGG + Intergenic
1146655331 17:34631633-34631655 ATCTCAGAGGGGTGGGTGGAGGG - Intronic
1147188350 17:38724996-38725018 CCCTCAGAGGGGAGGCAGGAAGG - Intronic
1147602655 17:41755650-41755672 GTTTCAGCGGGGAGATGGGAGGG + Exonic
1147702034 17:42402387-42402409 GTTACAGAGGGCAGGTGGGAAGG - Intergenic
1147930446 17:43977299-43977321 CTATCAGAGAGGAGGGTGGAAGG + Intronic
1148084755 17:44987435-44987457 CTCTGACAGGGGAGGTGGGATGG + Intergenic
1148217639 17:45842042-45842064 ATTTCAAAGGGGAGGTTGGCAGG - Intergenic
1148677235 17:49452444-49452466 CTTTCAGGGTGGTGGGTGGAGGG + Intronic
1148696870 17:49565898-49565920 ATTTCAGATGGGAGGATGGGGGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149118082 17:53123707-53123729 CTTTGAGAGGCCAGGTTGGGAGG - Intergenic
1149508061 17:57212414-57212436 CCTTCACTGGGGGGGTTGGATGG - Intergenic
1151366077 17:73617252-73617274 CCTGCAGAGGGGAGGTGAGAGGG + Intronic
1152021699 17:77783049-77783071 CTTTCAGAGTGGAAATTGAAAGG - Intergenic
1152147596 17:78577525-78577547 CATTTTGAGGGGAGGTTGGAGGG + Intergenic
1152590348 17:81208616-81208638 CATTCAGAGGGCAGGTGGAAAGG + Intronic
1152898056 17:82925021-82925043 CTTTCAGAAGGAAGCCTGGAAGG - Exonic
1153264008 18:3250073-3250095 ATTTCAGGGGGGAGGGGGGAGGG + Intronic
1154159060 18:11966813-11966835 CTTTGGGAGGTGAGGTGGGAGGG + Intergenic
1154431725 18:14313758-14313780 GTTGGAGAGAGGAGGTTGGATGG + Intergenic
1155358448 18:24977107-24977129 CTTTCTGAGAGGAGGTGAGAGGG - Intergenic
1155558782 18:27052022-27052044 GTTTCAGAAGGGAGGCTGAAAGG + Intronic
1157452846 18:47801200-47801222 CCTGCAGTGGGGGGGTTGGAGGG - Intergenic
1158640669 18:59201035-59201057 CTTAGTGTGGGGAGGTTGGATGG - Intergenic
1161497997 19:4597951-4597973 CGTTCAGAGGGGAGGGGTGAGGG + Intergenic
1162010911 19:7814347-7814369 CATTCAGAGCTGATGTTGGAGGG - Intergenic
1162547599 19:11339726-11339748 CTTTCAGAGAGCGGGTGGGAGGG + Intronic
1162833906 19:13303703-13303725 CTGGCAGAGGAGAGGTTGCAGGG - Intronic
1163652976 19:18529672-18529694 GGTGCAGAAGGGAGGTTGGAGGG - Intergenic
1164425600 19:28138816-28138838 CTTTCATAGGGGTGGTTGCAGGG - Intergenic
1164600327 19:29558704-29558726 CTGTCAGTGGGGAGGTTAGGAGG + Intronic
1164728867 19:30486248-30486270 TTGTCAGCGGGGAGGTTGGGAGG - Intronic
1164769743 19:30799395-30799417 TTTCCAAAGGGGAGGTTGCACGG + Intergenic
1166190952 19:41176210-41176232 GCTGCAGAGGGGAGGGTGGAGGG + Intergenic
1167498207 19:49831310-49831332 CTGCCAGAGGGGAGGAAGGAGGG - Intronic
1168365522 19:55783599-55783621 CTTTCAGAGGCTGAGTTGGACGG + Intergenic
1168557619 19:57356300-57356322 GCTTCAGAGGGGATGATGGAGGG + Exonic
1168709689 19:58491887-58491909 TTTTCGGAAGGGCGGTTGGAAGG - Intronic
925104552 2:1279676-1279698 TTTTCAGATGGGAAGTTGGCTGG + Intronic
925390421 2:3490418-3490440 CTCTCAGTGGAGAGGTTAGAGGG - Intergenic
926464859 2:13175639-13175661 ATTTCAGAGGGAAGGCTTGATGG - Intergenic
930017213 2:46979177-46979199 TTTCAAGAGGGGAGGGTGGAGGG + Intronic
931459797 2:62440711-62440733 TCTTCATAGGGGAGGCTGGAGGG - Intergenic
932447471 2:71789711-71789733 GATTCAGAGGGGAGAGTGGACGG + Intergenic
932629152 2:73323415-73323437 GTTTAAGTGGGGAGGTTGGGAGG - Intergenic
932797917 2:74713617-74713639 CTTTCAGAGGGAAGCATGGAGGG - Intergenic
934661741 2:96146692-96146714 CTTTCAGAGGGCACGGAGGAGGG - Intergenic
934936218 2:98467316-98467338 ATTTCAGTGTGGAGTTTGGAGGG + Intronic
935074890 2:99731511-99731533 CTGTGAGCGGGGAGGTGGGAGGG - Intronic
935098287 2:99968142-99968164 CTTACTGAGGGGAGCTGGGAAGG - Intronic
935899636 2:107777348-107777370 CTGTCAGACTTGAGGTTGGAAGG - Intergenic
936043272 2:109166074-109166096 CTTTCAGAGTGGAGACTGGTGGG + Intronic
937341564 2:121094558-121094580 CTTTCAGAGGCCAAGTTGGGCGG + Intergenic
938698312 2:133854383-133854405 CTTTCACATGGGAGCTTCGAAGG - Intergenic
938885723 2:135645940-135645962 CTTTCATAGGGTAGGTAGAATGG - Intronic
938986270 2:136579501-136579523 CTTTCACTGGGGAGGAGGGAAGG - Intergenic
939976529 2:148723019-148723041 CCTTCAGGGTGGAGGATGGAAGG + Intronic
940594260 2:155769399-155769421 CCTTCTGAGGTGAGGTAGGAAGG + Intergenic
940639712 2:156333374-156333396 CTTTCAGATGGGAGTGTGGGGGG - Intronic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
943430905 2:187800349-187800371 CTTCGAGAGTGTAGGTTGGAAGG + Intergenic
943556376 2:189410324-189410346 CTTTCAGAGGCCAAGTTGGGAGG + Intergenic
945023118 2:205594035-205594057 CTTGCAGAGGGCAGGCTGAAGGG + Intronic
947573068 2:231250558-231250580 CTCCCAGAGGGGAGGGTAGACGG + Intronic
948906907 2:240983974-240983996 CGTTGAGAGGGGAGGTTGTGGGG - Intronic
1169176574 20:3521093-3521115 ACTTGAGAGGGGAGGTTGGGAGG + Intronic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1170487041 20:16828866-16828888 ATTTCAGTGGGGAAGTGGGAAGG + Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1177024029 21:15899275-15899297 ACTTGAGAGGGGAGGGTGGAAGG - Intergenic
1177794673 21:25761419-25761441 CTATCAGATGGGAGCTTTGAGGG - Intronic
1180085599 21:45506749-45506771 GTTCCAGAGGGAAGGTGGGAGGG - Intronic
1180611322 22:17100046-17100068 ATTTGAGAGGGCAGGTGGGAGGG + Intronic
1181634423 22:24167958-24167980 CTTTAAGTGGGCAGGATGGAGGG - Intronic
1181857639 22:25793480-25793502 CTTTGAGAGGCCAGGGTGGAAGG - Intronic
1182748937 22:32626535-32626557 TTTTCAGAGGGGAGGAAGGAAGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1184331573 22:43831152-43831174 CTTTCACTGGGGAGCCTGGAAGG + Intronic
1184450390 22:44579052-44579074 AGTTCAGAGGAGAGATTGGAGGG - Intergenic
950372519 3:12543214-12543236 CTTTCAGAGAGTATGATGGAAGG - Exonic
951546221 3:23828940-23828962 CTTTCAGTGGACAGGGTGGATGG + Intronic
952856584 3:37776177-37776199 ATTTGAGAATGGAGGTTGGAAGG + Intronic
953417025 3:42728391-42728413 CTTGCACAGGGGAGGGTGGGGGG - Intronic
953535659 3:43774925-43774947 CTTTCAGGGGAGAGCATGGATGG - Intergenic
954419190 3:50409679-50409701 CTCTCTGAGGGCAGGGTGGAAGG + Intronic
955349940 3:58185893-58185915 CTGTCAGAAGGGAGGTGGTATGG - Intergenic
955545036 3:60019084-60019106 CTTTCAGATGGAAGGTAGGCTGG + Intronic
956695139 3:71912351-71912373 TTTGGAGAGGGAAGGTTGGATGG + Intergenic
958514023 3:95088968-95088990 CAATCAGAGGGGAGATTAGAAGG - Intergenic
961475607 3:127144567-127144589 AAGTCAGAGGGGAGGTGGGAGGG + Intergenic
961828213 3:129609684-129609706 CTTCCAGAGGGAATTTTGGAGGG + Intergenic
962653432 3:137518547-137518569 ATTTCAGGTGGGAGGTTGGATGG + Intergenic
963244741 3:143047756-143047778 CGTTCAGGAGGGAGGTGGGAGGG - Intronic
963703323 3:148654426-148654448 CTTTGACAGGGGAGGGTGGTAGG - Intergenic
964703068 3:159590330-159590352 CTTTCAGAGGCGAAGGTGGGAGG + Intronic
965799576 3:172477687-172477709 CTTCAAGTGAGGAGGTTGGATGG + Intergenic
966742713 3:183249324-183249346 TTTTCACAGGGGCTGTTGGAGGG + Intronic
966828063 3:183982131-183982153 CTTCCAAAGGGGAGGCAGGAGGG + Intronic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967811704 3:193766210-193766232 CTTACAGAGGGGAGCTTTGTGGG - Intergenic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
969320327 4:6408522-6408544 GTTTCAATGGGGAGGTAGGATGG + Intronic
969594285 4:8140096-8140118 CTGTCAGAGGGGTGGGGGGAGGG + Intronic
971409000 4:26350623-26350645 CATTAAGAGGTGAGGATGGAGGG + Intronic
972279241 4:37586664-37586686 CTTTCAGAGGCCAAGGTGGATGG + Intronic
973052176 4:45609988-45610010 TTTTAAGGTGGGAGGTTGGAGGG - Intergenic
973606244 4:52590127-52590149 CCATCTGAGGGGAGGTTGTATGG + Intergenic
973896372 4:55417654-55417676 GGTTCAGAGGGGAGGTTTGGGGG + Intronic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974992630 4:69113668-69113690 GATTCAGAGGGGAGGGTGGGAGG - Intronic
977898281 4:102388858-102388880 ATTTCAGAGGTGAGGTGGCAAGG - Intronic
978154915 4:105478404-105478426 CTTTGAGAGTGGAGAGTGGATGG + Intergenic
979919303 4:126478468-126478490 CTGTCAGAGAGGAGTTTGGCTGG + Intergenic
981790467 4:148530596-148530618 CTTTCAGAGGAGGGGTTGTGGGG - Intergenic
981975379 4:150722100-150722122 TGTTCTGAGGGGAGGGTGGAAGG - Intronic
983019371 4:162656222-162656244 TCTTCAGAGGGGAGGGGGGAGGG - Intergenic
983884277 4:172963068-172963090 GAGTCAGAGAGGAGGTTGGAGGG - Intronic
984784779 4:183557438-183557460 GTCTGAGAAGGGAGGTTGGAGGG - Intergenic
986374296 5:7114721-7114743 CCTTCAGAGGGGAGGCAGGGAGG - Intergenic
987167386 5:15214907-15214929 ATTTCATAGGGGATATTGGAGGG - Intergenic
988520188 5:31938772-31938794 TGTTCAGAGGTAAGGTTGGAGGG - Intronic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
990200841 5:53371420-53371442 CTCTCAGGGGAGAGGTGGGAGGG + Intergenic
991653902 5:68883666-68883688 CTTTCAGGGAGAAGGTGGGAGGG - Intergenic
993315994 5:86407123-86407145 CTTTCCTAGGGGAGTTGGGAAGG - Intergenic
993485494 5:88479224-88479246 TTTGGAGAGGGGGGGTTGGAGGG + Intergenic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
995964265 5:117885187-117885209 TTTTCAGGGGGGAGGGAGGAGGG - Intergenic
996245889 5:121263433-121263455 TATGCAGAAGGGAGGTTGGAGGG + Intergenic
997738259 5:136230780-136230802 CTTCCAGAGGTGATGCTGGAAGG - Intronic
1001033593 5:168280731-168280753 ATTTCAGAGGGAAGGAGGGAGGG - Intergenic
1001273718 5:170334900-170334922 GTTTCAGAGGGGAGGCAGAAAGG + Intergenic
1003558054 6:7158253-7158275 CTTTCAAAGGGGAGGCAGGTGGG - Intronic
1003687768 6:8322089-8322111 CTTTCATAGGAGAGTTTAGAAGG - Intergenic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1004238974 6:13901506-13901528 GTTACAGTGGGGATGTTGGATGG + Intergenic
1005399151 6:25413721-25413743 CCTTCCCAGGGGAGGTGGGAGGG + Intronic
1006261314 6:32873940-32873962 CTGTCTGGGGCGAGGTTGGAGGG - Intergenic
1007250976 6:40494709-40494731 CTTTCAGAGGTGAGGTGTTATGG - Intronic
1007593480 6:43037566-43037588 ATTTGAGTGGGGAGGTGGGAGGG - Intergenic
1009508971 6:64523829-64523851 ATTTCAGATGGGAGGGAGGAAGG - Intronic
1010144477 6:72650965-72650987 TTTTAAGAGGGCAGGTGGGAAGG + Intronic
1012626040 6:101403708-101403730 CTTTGAGAGGTGAGGTGGGCGGG + Intronic
1014570071 6:122997038-122997060 ATCTCAGAGGGGTGGTGGGAAGG + Intronic
1015111087 6:129592694-129592716 CTTTGAGAGGTGAGCTTGAATGG + Intronic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1018989350 6:168661595-168661617 TTTTTTGGGGGGAGGTTGGATGG - Intronic
1019504757 7:1385329-1385351 CTTGCAGATGGGAGGTTGGGTGG + Intergenic
1020385474 7:7596949-7596971 CTTTGAGAGGCCAGGGTGGAAGG + Intronic
1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG + Intergenic
1024344826 7:48302491-48302513 ATTTGAGGGTGGAGGTTGGAAGG - Intronic
1024366406 7:48525887-48525909 CTGTCAGAGGGATGGTGGGAGGG - Intronic
1025813072 7:64887874-64887896 ATTTCAGAGGGGTGGTCGGGTGG + Intronic
1026657189 7:72267128-72267150 CTTTCTAAGAGGAGGTTTGAAGG - Intronic
1026738584 7:72964499-72964521 CTGGCAGAGGGGAGCTTTGAGGG - Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1026789598 7:73323142-73323164 CTGGCAGAGGGGAGCTTTGAGGG - Intronic
1027105150 7:75400570-75400592 CTGGCAGAGGGGAGCTTTGAGGG + Intronic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027193627 7:76012962-76012984 CATTCAGAGGGCAGGCTGGATGG - Intronic
1027250547 7:76396093-76396115 CTTTAAGAGGGGCTGTAGGAGGG - Intronic
1027619917 7:80471601-80471623 CTTTCAGAGAGAAGGCGGGAGGG - Intronic
1028830460 7:95322106-95322128 CATTCATAGGGGAGACTGGAGGG + Intronic
1029546423 7:101212711-101212733 CTGTCAGGGTGGAGGTTGGGTGG - Intronic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1031234476 7:119156397-119156419 CTCTCAGAGTGGAGGGTGGGAGG + Intergenic
1031387976 7:121176174-121176196 TTTCCAGCGGGGAGGATGGAGGG - Intronic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032526686 7:132583197-132583219 CTTTTGGAGGTGAGGTTGAATGG + Intronic
1032926225 7:136608325-136608347 CTTTCAGAGGGTAGTTGAGAGGG - Intergenic
1033422019 7:141212105-141212127 TGTTCAGAGGTGAGGTTGGGAGG + Intronic
1034495229 7:151416873-151416895 GTTTCAGAGAGGAGGCAGGAGGG - Intergenic
1036803366 8:11809095-11809117 CTTTCAGAGAAGAGGGGGGAGGG + Intronic
1037504370 8:19515753-19515775 CTTTTAGAGAGGAGGCTTGATGG + Intronic
1037907355 8:22723419-22723441 CTTTCTGAAGGCAGGATGGAGGG - Intronic
1037920509 8:22802257-22802279 CTTTCTGGGTGGAGGTTGGCAGG + Intronic
1038439043 8:27558929-27558951 CTCTCTGAGGGAAGGTGGGAGGG - Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1041342309 8:56858708-56858730 ATTTCAGAGGGGAGAGTGGCAGG - Intergenic
1042182468 8:66105228-66105250 CCTTCAAAGGGGAGGTAGGCTGG + Intergenic
1042837006 8:73088018-73088040 CTTTCTTAGAGGAGGTGGGAAGG + Intronic
1044522578 8:93216436-93216458 CTTTTATAGGAGAGGTGGGAGGG + Intergenic
1045872993 8:106947235-106947257 CTTACATGGGGGAGCTTGGAAGG - Intergenic
1046098293 8:109585715-109585737 TTCACAGAGGGGAGGTAGGAGGG + Intronic
1048064331 8:130952043-130952065 GTCTCAGATGGGAGGGTGGAGGG + Intronic
1049599339 8:143499822-143499844 ATGTCAGAGGGGAGGTAGCAGGG + Intronic
1050034555 9:1421693-1421715 CTTTCAGAGAAGAGGTGAGAAGG + Intergenic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1050612598 9:7368692-7368714 CTTTCAGAGGGGTGCAGGGATGG + Intergenic
1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG + Intronic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056456878 9:86768742-86768764 CTCACAGATGGGAGGTTGGAAGG - Intergenic
1057024987 9:91727955-91727977 CTTTCAGAGGGGAAGCTGCTAGG - Intronic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1059134880 9:111795308-111795330 CTTTCAGAGGTAAGGGTGGGAGG + Intergenic
1060116754 9:120947647-120947669 CTTTGACAGGGCAGGTTGGGTGG - Intergenic
1060886336 9:127155166-127155188 ATTTCAGAGGCCAGGTTGAAGGG + Intronic
1062422531 9:136490112-136490134 CTCTCAGAGGGGGCGTTGCAGGG - Intergenic
1185581161 X:1212577-1212599 CTTTCTGCTGGGAGGCTGGATGG - Exonic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186932123 X:14405353-14405375 CATTCAGAGGGAAGGTAGGAGGG + Intergenic
1188526573 X:31094166-31094188 CTGTCAGAGAGGAGTTTGGCTGG - Intergenic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1190425225 X:50329273-50329295 CTTTATGAGGGCAGTTTGGAAGG - Intronic
1190794577 X:53729107-53729129 CTTTGGGAGGTGAGGTTGGGGGG - Intergenic
1192767185 X:74152670-74152692 CCTTGAGGGTGGAGGTTGGAAGG + Intergenic
1192856141 X:75014367-75014389 CTGTCAGAGGGTGGGTTGGAGGG - Intergenic
1194202171 X:90965866-90965888 TTTTCAGAGGGGATGTAAGATGG + Intergenic
1194583414 X:95704630-95704652 CTTTGTGAGGGGGGGTTGGGAGG - Intergenic
1195138362 X:101932909-101932931 CTTTGAGAGGAGAGGTTGGGGGG - Intergenic
1196741094 X:119026704-119026726 CTGTCAGAGGGGTGGTGGGAGGG + Intergenic
1196771334 X:119297340-119297362 CCTTGAGAGTGGAGGTTGGGAGG + Intergenic
1200293571 X:154894726-154894748 CTTTTTGAGGGGGGGTAGGAAGG - Intronic
1200548008 Y:4541320-4541342 TTTTCAGAGGGGATGTAAGACGG + Intergenic
1202047381 Y:20748530-20748552 CTTTGGGAGGTCAGGTTGGAAGG + Intergenic