ID: 1050297925

View in Genome Browser
Species Human (GRCh38)
Location 9:4225440-4225462
Sequence CCATCACTGAATTCCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050297925_1050297928 11 Left 1050297925 9:4225440-4225462 CCTCCATTGGAATTCAGTGATGG 0: 1
1: 0
2: 1
3: 3
4: 118
Right 1050297928 9:4225474-4225496 CTCATTCCTGCAACCTAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050297925 Original CRISPR CCATCACTGAATTCCAATGG AGG (reversed) Intronic
904258630 1:29273815-29273837 GCATCAGTGAATTCCTATTGGGG + Intronic
907881179 1:58550458-58550480 CCATCACTGAAATCCACACGGGG + Intergenic
915432873 1:155880147-155880169 ACGTCACTGAATTCCAATCTGGG + Intronic
915773936 1:158461874-158461896 CCATCACTGATCTCCATGGGAGG - Intergenic
917460132 1:175222381-175222403 ACATGTCTGAATTCCAGTGGTGG - Intergenic
920793404 1:209114383-209114405 CTATCACTGAATTCCTTTTGGGG - Intergenic
921007155 1:211105290-211105312 CCATCACTTCATTTAAATGGAGG - Intronic
922468931 1:225863516-225863538 CCATCACTGAAATCCTATTCAGG + Intronic
922661570 1:227434883-227434905 GCACCACTGCATGCCAATGGAGG + Intergenic
923251185 1:232180798-232180820 CCATCACTGAATGACATTTGGGG - Intergenic
1063073093 10:2686551-2686573 CTGTCACTGAATTCCGAAGGGGG + Intergenic
1070520995 10:77253498-77253520 CCATCACTGACTCCAAGTGGAGG - Intronic
1070644757 10:78194154-78194176 CCATAACAGAATTCAAATGCAGG + Intergenic
1077496741 11:2890326-2890348 CCCTCACAGAAGTCCTATGGAGG - Intronic
1077558779 11:3242603-3242625 CTATCTCTAAATTCCACTGGTGG + Intergenic
1079265750 11:18931030-18931052 CCATCAGTGAATTGCCATGAAGG + Intergenic
1081409948 11:42745966-42745988 CCATCACTTAATGCCAAAAGGGG - Intergenic
1082087165 11:48059468-48059490 CCCTCCCTGAATTAGAATGGAGG + Intronic
1084838275 11:71822306-71822328 CCACCACTGAACTCCAACGAGGG + Intergenic
1086253425 11:84845654-84845676 CGATCACAGAATTCAAATGAAGG - Intronic
1090086037 11:123652067-123652089 CCCTGCCTGAATTCCAGTGGAGG - Intronic
1090176830 11:124657346-124657368 GCAGAACTGAATTCCAAAGGAGG - Intronic
1090964924 11:131590259-131590281 TCATCATTCAATTCCCATGGTGG + Intronic
1093281576 12:17202786-17202808 CCAAGACTGAATTCATATGGAGG + Intergenic
1093638379 12:21497854-21497876 CCAACCTTGAGTTCCAATGGAGG + Intronic
1094095226 12:26696518-26696540 TCATCACTAAATACCAATGAGGG + Intronic
1095892392 12:47246982-47247004 ACATCACTGCATTCCAACGTGGG + Intergenic
1106195387 13:27489688-27489710 CCTTGACTGAAGTCCCATGGTGG + Intergenic
1107462734 13:40619645-40619667 ACCTCAGTGAATTTCAATGGTGG + Intronic
1107520351 13:41174557-41174579 CCATCACTGCATTCCAGTTTGGG - Intergenic
1111021702 13:82459361-82459383 CAATTACTGAATACCCATGGTGG - Intergenic
1114473539 14:22979604-22979626 CCATCTCTGAATTCAAAATGTGG + Intronic
1114715916 14:24824580-24824602 ACATCACTGCATTTCAATGTTGG + Intronic
1115108398 14:29789605-29789627 CTATAAGTGAATGCCAATGGTGG + Intronic
1117569259 14:57030059-57030081 GCATCACTGAACTCCAGTGTGGG - Intergenic
1117997465 14:61491162-61491184 ACAGAACTGAATTCCAATAGAGG - Intronic
1118014945 14:61650845-61650867 CCACCACTGAACTCTAATAGCGG - Intronic
1119895131 14:78213645-78213667 CCATCACTGCATTCACATTGCGG - Intergenic
1123753527 15:23378150-23378172 CCATCACTGCACTCCAACGTGGG + Intergenic
1128026815 15:64444780-64444802 CCATCTCTGATTTCCTATAGTGG - Intronic
1129995367 15:80000163-80000185 CCACCACTGCAATTCAATGGTGG + Intergenic
1129995366 15:80000163-80000185 CCACCATTGAATTGCAGTGGTGG - Intergenic
1130092793 15:80835329-80835351 CCATCGCTGAGTTCCAAAGTAGG + Intronic
1132841612 16:1980843-1980865 CCATCAGTGACTCCCACTGGAGG - Exonic
1137863063 16:51866161-51866183 ACATCCCTGAATTCCTTTGGTGG + Intergenic
1140229872 16:73108831-73108853 TCATTACTGAGTTCCAATGAAGG - Intergenic
1141117506 16:81323033-81323055 CCATCACTGAAGTAGACTGGGGG - Intronic
1143509232 17:7386408-7386430 CCCTCACTGAATTACAATGGGGG + Intronic
1146419648 17:32671194-32671216 GCATCACTGCATTCCCCTGGGGG + Intronic
1147815353 17:43205833-43205855 ACACCACTGAACTCCAATGTGGG + Intronic
1151110660 17:71674138-71674160 ACATCACTGAATTCTAATCAAGG + Intergenic
1152997231 18:418993-419015 ACATGACTGACTACCAATGGGGG - Intronic
1153213762 18:2797574-2797596 GAATTACAGAATTCCAATGGAGG - Intronic
1159292514 18:66440447-66440469 CCATCAGTGGATTCCACTGTAGG - Intergenic
1159453338 18:68630200-68630222 CCATCACTGAATACATATGCAGG - Intergenic
1160089844 18:75816494-75816516 CCATAACTGACTACCACTGGGGG + Intergenic
1161774811 19:6254563-6254585 ACATCACTGAATTCAACTGCAGG + Intronic
1163493809 19:17632987-17633009 CCATCACTGATTTCCAACTCAGG + Intronic
1166798292 19:45441058-45441080 CAATCACTGACTTGCAAGGGAGG - Intronic
925062921 2:906994-907016 ACATCAATGAATTTCAATGTAGG - Intergenic
928918821 2:36503911-36503933 GCACCACTGAATTCCAATCTGGG - Intronic
931672137 2:64656621-64656643 ACACCACTGCATTCCAATGTAGG + Intronic
933994429 2:87657366-87657388 CCATCACATAATTCCAGTGAGGG + Intergenic
936299429 2:111293547-111293569 CCATCACATAATTCCAGTGAGGG - Intergenic
937034258 2:118767820-118767842 CCTTCACTTCTTTCCAATGGAGG + Intergenic
947302160 2:228700242-228700264 CCATGAGGGAATTCCAGTGGAGG - Intergenic
1170793732 20:19528620-19528642 CCATGAGTGGATTCCAAAGGTGG + Intronic
1174097312 20:48099558-48099580 CCATCACTGAGTGCCAGGGGTGG + Intergenic
1180713439 22:17855696-17855718 TCATCACTGAGGTGCAATGGGGG - Intronic
951497580 3:23348268-23348290 CCATCACAGAATTCCACCAGTGG - Intronic
953369381 3:42374474-42374496 CCATCACTAAATCCCAAAGCTGG - Intergenic
954091581 3:48288713-48288735 TCATGACTTAATTACAATGGTGG + Intronic
955094516 3:55783809-55783831 CCAACACTGAAAGCCAAAGGTGG + Intronic
956703901 3:71982963-71982985 CCATAGGTGAATTGCAATGGAGG - Intergenic
956810265 3:72857522-72857544 CCCAGGCTGAATTCCAATGGTGG - Intronic
959904423 3:111694716-111694738 CCAGCTCTGACTTCCCATGGAGG - Intronic
960216492 3:115044583-115044605 ATATCAGTGATTTCCAATGGTGG + Intronic
981856643 4:149301521-149301543 CTATCATTGAATTTCAATGTAGG - Intergenic
983722389 4:170871855-170871877 CCATCAATGAATGCCAATGCTGG + Intergenic
985864182 5:2500420-2500442 ACACCACTGCATTCCAAAGGTGG + Intergenic
986256990 5:6108993-6109015 CCATAACTTGATTCTAATGGTGG - Intergenic
987622466 5:20353126-20353148 CCAAAAATGTATTCCAATGGAGG - Intronic
989176709 5:38534768-38534790 CCATCCCTGTGTTACAATGGGGG - Intronic
990890606 5:60645607-60645629 ACATCTCAGAATTCTAATGGAGG + Exonic
991220356 5:64207442-64207464 TCATCTCTGAACTCCAATAGTGG - Intronic
996825556 5:127677760-127677782 CCATAAGTGAATCACAATGGAGG + Intergenic
997836850 5:137201395-137201417 TCATCACTTAATTCTAGTGGGGG + Intronic
998882719 5:146659937-146659959 TCATGACTGAATTCCCTTGGTGG - Intronic
1003964412 6:11239417-11239439 CCTTCACTGAATTCAACAGGGGG + Intronic
1005003661 6:21267052-21267074 TCATCCTTGAATTCCCATGGGGG - Intergenic
1005567382 6:27110388-27110410 CCTTTACTGAATTCCATTAGCGG + Intergenic
1007262138 6:40571426-40571448 CCAACACTGCTTTCCCATGGTGG - Intronic
1017686665 6:156920243-156920265 TCATCCCTCAATACCAATGGGGG - Intronic
1017772003 6:157650970-157650992 CCATCAGGGAACTGCAATGGGGG - Intronic
1018012930 6:159688191-159688213 CCTGCACTGAAGTTCAATGGTGG - Exonic
1018103673 6:160463740-160463762 CCTTCACTGAATTCCTAGGATGG + Intergenic
1018687380 6:166314319-166314341 CAATTACTGAATACCAATTGTGG - Intergenic
1022776747 7:33534709-33534731 CCATCACTGACTGCCCATGGAGG - Intronic
1022807837 7:33840887-33840909 CCATCAATGAAAGTCAATGGTGG + Intergenic
1023135715 7:37049659-37049681 CCATCACAGATTTCCTATGAAGG + Intronic
1028788553 7:94825999-94826021 CCATGCCTGAAATCCAAAGGAGG - Intergenic
1030585085 7:111407711-111407733 CCATCACTGTAATCCAATTTTGG - Intronic
1033933992 7:146560129-146560151 CCATCACTGAATTCCTTTGCAGG + Intronic
1034656412 7:152733157-152733179 ATATCACTGAATTACTATGGAGG + Intergenic
1041015268 8:53586904-53586926 GAATCACTGAATTCCAGTGCTGG - Intergenic
1046099679 8:109600242-109600264 CTATCCCTAAATGCCAATGGTGG - Intronic
1046273823 8:111931142-111931164 CCAACTCAGCATTCCAATGGAGG + Intergenic
1048231947 8:132651143-132651165 CCAACACTGACTGCCAAAGGCGG + Intronic
1050068435 9:1785699-1785721 CCATCCCTGAATTCCAGTCTGGG + Intergenic
1050297925 9:4225440-4225462 CCATCACTGAATTCCAATGGAGG - Intronic
1050332627 9:4561063-4561085 AGATAACTGAATTCCAAAGGAGG + Intronic
1051784635 9:20729044-20729066 CAATTACAGATTTCCAATGGTGG + Intronic
1056943876 9:90977441-90977463 CCACCACTGAACTCTAATGCTGG - Intergenic
1057666821 9:97052417-97052439 CCATCTCTAAATTCCACCGGTGG - Intergenic
1058748853 9:108018882-108018904 AAAACATTGAATTCCAATGGAGG - Intergenic
1060475192 9:123981489-123981511 CCATCAATGAATTCCACTTTTGG - Intergenic
1062348367 9:136126126-136126148 ACATCACTGCTTTCCAACGGTGG - Intergenic
1185804694 X:3046515-3046537 CCATCTCTAAATTCCTCTGGTGG - Intronic
1185934741 X:4243311-4243333 CCATCTCTGAATTTCAATTTGGG - Intergenic
1187377794 X:18772104-18772126 GCATCACTGCACTCCAATGTAGG + Intronic
1190968547 X:55326933-55326955 CTTTCACTGACATCCAATGGCGG + Intergenic
1195891778 X:109703006-109703028 CCATCAGTGAATGCTAATGCTGG + Intronic
1201276528 Y:12303834-12303856 CCATCTCTAAATTCCTCTGGTGG + Intergenic