ID: 1050297927

View in Genome Browser
Species Human (GRCh38)
Location 9:4225443-4225465
Sequence ATGCCATCACTGAATTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050297927_1050297931 29 Left 1050297927 9:4225443-4225465 CCATTGGAATTCAGTGATGGCAT 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1050297931 9:4225495-4225517 GGAACATAAATGCTTTAATGTGG No data
1050297927_1050297928 8 Left 1050297927 9:4225443-4225465 CCATTGGAATTCAGTGATGGCAT 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1050297928 9:4225474-4225496 CTCATTCCTGCAACCTAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050297927 Original CRISPR ATGCCATCACTGAATTCCAA TGG (reversed) Intronic
907930091 1:58990995-58991017 AGGCCATGACTTAATTACAAGGG - Intergenic
908780234 1:67684548-67684570 CTGCCATCCCTGAATACAAACGG + Intergenic
909783101 1:79574065-79574087 ATTCCATAACTGACATCCAAAGG + Intergenic
911621812 1:100073836-100073858 ATGACAGCACTGAGTCCCAAAGG - Intronic
915165110 1:153944127-153944149 AGTCCAGCACTGAGTTCCAAGGG + Exonic
915773938 1:158461877-158461899 ATGCCATCACTGATCTCCATGGG - Intergenic
916767989 1:167880310-167880332 ATGCCATAAACTAATTCCAACGG - Intronic
916968353 1:169978986-169979008 ATTCCCTCACTTAATACCAATGG + Intronic
918999161 1:191806268-191806290 ATGCCAGACCTGAATCCCAAAGG + Intergenic
919825351 1:201499537-201499559 GTGCCATGGCTGAGTTCCAAGGG - Intronic
921081929 1:211747491-211747513 TTGCCATCACTGTGCTCCAAAGG - Exonic
923859760 1:237881796-237881818 ATACCATCACTGACTTCTCAAGG - Intronic
924490924 1:244536534-244536556 AGGGCAGCACTGAATTCCGACGG + Intronic
1063000450 10:1913477-1913499 ATGTCACCATTGAATTCCAAAGG - Intergenic
1065129657 10:22608078-22608100 CTGCCACCACTGAGTTCCACAGG + Intronic
1065203727 10:23338638-23338660 ATAAGATCACTGAATTCCATGGG - Intronic
1065265564 10:23971530-23971552 CAGCCATGACTGAATTCCAAGGG - Intronic
1065309369 10:24399556-24399578 ATCCCATCTCTAAATTCTAATGG + Intronic
1069580122 10:69560077-69560099 AGACCACCACTGAATTTCAAGGG - Intergenic
1070667586 10:78356347-78356369 ATGCAATCACAGAATTCAAGGGG - Intergenic
1071879601 10:89881786-89881808 CTGCCTTCACTGTATTCCATAGG + Intergenic
1074321980 10:112411838-112411860 ATGCCAACTTTCAATTCCAATGG - Intronic
1075196029 10:120359845-120359867 CTGCCATCACAGAATACCATAGG + Intergenic
1076219082 10:128718530-128718552 ATGCCAGCACTGACAGCCAAAGG + Intergenic
1077712511 11:4551273-4551295 ATTCCAACACTGAACTCCATTGG + Intergenic
1077793582 11:5467490-5467512 ATGGCATAACTCAACTCCAATGG - Intronic
1078337977 11:10478678-10478700 ATGCCATGCCTGAGTTCCAGCGG + Exonic
1078597842 11:12703731-12703753 ATGCAATAACTGAATTCCAGTGG - Intronic
1078697560 11:13649586-13649608 AATCCATCTCTGAATTCCACTGG + Intergenic
1079809144 11:24973265-24973287 ATACCATCACTGACTTCCACAGG - Intronic
1080336628 11:31204927-31204949 ATGGCATGACTGAATTTGAAGGG - Intronic
1080597515 11:33787416-33787438 ATGCCATCTCTGGATTACACAGG + Intergenic
1082216721 11:49579609-49579631 ATGTCATCACAGAATTCCAGAGG + Intergenic
1083529043 11:63400332-63400354 CTGACATCACAGAAATCCAATGG + Intronic
1083873088 11:65503362-65503384 ATCCCATCACTGAAGCCCACAGG - Intergenic
1085157329 11:74307834-74307856 AAACCATTTCTGAATTCCAAAGG - Intronic
1086632832 11:89044465-89044487 ATGTCATCACAGAATTCCAGAGG - Intronic
1089112512 11:116068049-116068071 CTGCCATCACAGAATACCACAGG + Intergenic
1091126811 11:133107394-133107416 ATGCCCTCACTGATTTACAGAGG + Intronic
1092292283 12:7168666-7168688 AAGCCAACAGTGAATCCCAAAGG - Intergenic
1093814237 12:23524713-23524735 ATGCCTTCACTAAATACAAATGG + Intergenic
1094107041 12:26824898-26824920 ATGCCATCAATACATTCAAAAGG + Intronic
1096567014 12:52490511-52490533 GTGCCATCCCTGAATACCAGAGG - Intronic
1096868875 12:54580954-54580976 ATACCACCACTGGATTCCAAGGG - Exonic
1098689993 12:73474860-73474882 ATGCCATCACTCACTTCAAAAGG - Intergenic
1103344108 12:120237964-120237986 ATGGCATCACTGAGCTACAAAGG + Intronic
1103732190 12:123035152-123035174 ATGACATCACTACATCCCAAGGG + Intronic
1104448659 12:128852961-128852983 AAGCCATCACTGGTTTCCATGGG + Intergenic
1105383477 13:19909292-19909314 AAGTCATCACTGAATTCCAGTGG - Intergenic
1106453708 13:29908612-29908634 CTGCCATCTCTCACTTCCAAAGG + Intergenic
1110490116 13:76093574-76093596 ATGCCTTCATTTAATTTCAAGGG + Intergenic
1111892428 13:94100572-94100594 ATCCAAACACTGAACTCCAAAGG - Intronic
1112664368 13:101552985-101553007 ATTGCATCACTGAATTCCAGTGG - Intronic
1113483842 13:110640624-110640646 CTGGCATCTCTGAATCCCAAGGG - Intergenic
1113816751 13:113176948-113176970 CTGCCATCACAGAATACCACAGG - Intergenic
1117501310 14:56354813-56354835 ATACCTTCAATGAACTCCAAAGG + Intergenic
1117581766 14:57158313-57158335 CTCCCCTCACTAAATTCCAAAGG + Intergenic
1118143713 14:63113294-63113316 ATGCCATGGCTGAAACCCAAAGG - Intergenic
1119617754 14:76110060-76110082 ATGCCAACATTAAATTTCAAGGG - Intergenic
1119858080 14:77916001-77916023 ATGACACCACAAAATTCCAAGGG - Intronic
1120213767 14:81660275-81660297 ATTCCACTACTGAATTCCAGAGG + Intergenic
1121628422 14:95404568-95404590 ATCCCATCACCTCATTCCAAAGG + Intergenic
1125773240 15:42186505-42186527 TTGCCATGTCTGAATTACAAGGG + Intronic
1126486143 15:49183321-49183343 ATTCCATCACTGTAACCCAAAGG + Intronic
1127634790 15:60858918-60858940 AAGCAATCACTTATTTCCAAGGG - Intronic
1128043548 15:64596581-64596603 ATGCCATCTCTGATTACCCAAGG + Intronic
1130877208 15:88024829-88024851 ATGCCTTCACAGCATTTCAAAGG - Intronic
1132276741 15:100572658-100572680 ATGACATCACTGAATTGCTTTGG - Intronic
1132293233 15:100717706-100717728 ATGCCAGCTCTGCATTGCAATGG + Intergenic
1135503380 16:23016092-23016114 ATGCCATCAGTGATTTCCCCTGG - Intergenic
1136118411 16:28111633-28111655 CTGTCTTAACTGAATTCCAAAGG + Intronic
1136617499 16:31407603-31407625 ATGACATCACTGTATTCCAGGGG - Exonic
1140261802 16:73386803-73386825 CTGTCATCACTGAATTCTGATGG + Intergenic
1144239520 17:13296477-13296499 GTGCTATCACTGTATTCCAGTGG + Intergenic
1144663405 17:17086214-17086236 ATGCCAGCCCTGAAAGCCAATGG - Intronic
1146406874 17:32546253-32546275 AGTTCATTACTGAATTCCAAAGG - Intronic
1146556164 17:33826231-33826253 ATGGGACCACTGAATTTCAAGGG - Intronic
1146914722 17:36671256-36671278 ATGACATGACTGACTTCAAAGGG + Intergenic
1149085648 17:52712344-52712366 ATGCCATTACTAACTTCCCAAGG - Intergenic
1151697537 17:75725356-75725378 ATGGCATCACTGCATTTCACCGG - Intronic
1151746564 17:76014720-76014742 GTCCCATCTCTGAATTCCCAGGG - Intronic
1153292131 18:3511865-3511887 GTCCCATCACTGAATTCATAAGG + Intronic
1155439276 18:25844445-25844467 ATCCCATCAATCAATTCCACTGG + Intergenic
1156105518 18:33655063-33655085 ATGCCATCACCTCATTACAATGG - Intronic
1157041995 18:44050851-44050873 GTGGCACCAATGAATTCCAAGGG + Intergenic
1161604878 19:5209159-5209181 ATGCCATCACTGAATGGTTAAGG - Intronic
1163921016 19:20288686-20288708 ATCGCATCACTGCACTCCAACGG - Intergenic
1167136054 19:47616314-47616336 ATGCCAACACTGATTGCCTAGGG - Intronic
1167274790 19:48530530-48530552 CTGCCGGCTCTGAATTCCAAAGG - Intergenic
925602309 2:5621065-5621087 AGGGCCTCCCTGAATTCCAATGG - Intergenic
925644198 2:6019518-6019540 ATGCCAAAACTGAAGTCCACAGG + Intergenic
926332595 2:11837797-11837819 ATGTCTTCAATGAACTCCAAGGG + Intergenic
926837901 2:17044714-17044736 ATGGAATCACTGAATTCCTGGGG + Intergenic
928338178 2:30416932-30416954 ATGCCATCTCTGAATGTCCAGGG + Intergenic
930092372 2:47540431-47540453 ATGCCATCTCTAAATTAAAATGG + Intronic
930983336 2:57554787-57554809 GTGAAACCACTGAATTCCAAAGG + Intergenic
932203103 2:69850795-69850817 ATGACATCACTGAATGAGAAAGG + Intronic
938410368 2:131058926-131058948 ATGCCATCAAAGAATTATAAAGG + Intronic
938678181 2:133660143-133660165 CTGTCATCACTGTATTCCAAGGG + Intergenic
941509670 2:166389941-166389963 ATGACATCCCTTAATGCCAATGG - Intergenic
942187457 2:173437979-173438001 AGGAAATCACTGAATTCCATGGG - Intergenic
947205125 2:227653918-227653940 TACCCATCACAGAATTCCAAAGG - Intergenic
1169141881 20:3231145-3231167 GTACCATCAGTGAAGTCCAAGGG + Exonic
1177531732 21:22368789-22368811 ATGCTATTACTGAATTGCACTGG - Intergenic
1178576218 21:33794157-33794179 TTGACATGACTGATTTCCAAAGG - Intronic
1180724922 22:17939643-17939665 ATGGCATCAATGATTTCCAAAGG + Intronic
1181873966 22:25925348-25925370 ATGCTACCACTGAACTCGAAAGG - Intronic
1182608382 22:31525669-31525691 ATTGCATCACTGTATTCCAGTGG + Intronic
1184482132 22:44753845-44753867 ATGCCAACACTGCATTTCACAGG - Intronic
1185182689 22:49372371-49372393 CTGCTTTCACTGAGTTCCAAGGG - Intergenic
949214908 3:1554750-1554772 ATGCCCTCACTTAAATGCAAGGG + Intergenic
953194682 3:40721166-40721188 ATGCCCACACTGGATTCCCAGGG - Intergenic
953490795 3:43348397-43348419 ATACCACCACTGAATTGGAACGG + Exonic
954307831 3:49739697-49739719 ATGGCACCACTGCACTCCAATGG - Intronic
957564924 3:81872265-81872287 ATGTAATCACTGAATTTAAATGG + Intergenic
960144075 3:114180626-114180648 ATGCCATAACAAAATTCCACAGG - Intronic
961131886 3:124476503-124476525 ATGCCAACACAAAGTTCCAAAGG + Intronic
963307702 3:143671878-143671900 ATGTTTTCATTGAATTCCAAGGG - Intronic
965410970 3:168330776-168330798 ATGCCATCACTAAATTTCAGAGG + Intergenic
969023669 4:4156619-4156641 ATGCCACCACTCCATTCCTAGGG + Intergenic
973296907 4:48533409-48533431 CTGCAATCACTGATTTTCAAGGG + Intronic
973880192 4:55263574-55263596 ATGCCAAGACAGAACTCCAAAGG + Intergenic
974553435 4:63410870-63410892 ATTCCATCACTGATTCCCAAAGG - Intergenic
974749779 4:66122733-66122755 ATGCCATAACTGATGTCCAAGGG + Intergenic
980487107 4:133473064-133473086 ATGGTATCACACAATTCCAATGG - Intergenic
981480229 4:145230858-145230880 ATGAAATCTCTGACTTCCAAGGG + Intergenic
982082811 4:151807044-151807066 ATGTCATTACTGAATTAAAATGG + Intergenic
984570941 4:181392700-181392722 ATGCTGTCTCTGAATTCCAGTGG - Intergenic
986814309 5:11391598-11391620 ATGCCATTCTTTAATTCCAAAGG + Intronic
988858048 5:35248161-35248183 ATGCCCTTCCTGAATTCAAAAGG + Intergenic
992084592 5:73266692-73266714 ATGCCATCACTGTATTCTAGGGG + Intergenic
994992645 5:107016752-107016774 ATGCCATTACTGAGCTACAAAGG + Intergenic
995957259 5:117792651-117792673 ATGGCCTCACTCAATTGCAATGG - Intergenic
996399296 5:123043759-123043781 ATGCCCTCAAGGAATTTCAAAGG + Intergenic
997710448 5:135999613-135999635 ATGCCTATACTGAATTGCAAAGG - Intergenic
997833286 5:137171364-137171386 ATGCCCCCACTGACTTCCATGGG + Intronic
997837849 5:137210867-137210889 ATGACATCACTGGAGTCCAGGGG + Intronic
998097328 5:139403636-139403658 ATGACGTCACTGAGTTCCCATGG - Intronic
998213242 5:140217549-140217571 GGGCCATCACTTTATTCCAAAGG - Intronic
998270080 5:140698612-140698634 AGTCCATCACTCAATTCCAGAGG - Exonic
998704472 5:144743177-144743199 ATGCCAGCACAGAATCCCCATGG + Intergenic
1001334287 5:170784666-170784688 GTGGAATCACTGAATTCCCATGG + Intronic
1003022052 6:2518379-2518401 ATTCCAACACTGATTTTCAATGG + Intergenic
1003964408 6:11239414-11239436 CTGCCTTCACTGAATTCAACAGG + Intronic
1010585060 6:77648868-77648890 TTGCAATCGCTGAAATCCAATGG - Intergenic
1012501664 6:99895401-99895423 ATTCCTTCACTGAATTTTAATGG + Intergenic
1012727503 6:102833726-102833748 AAGCCTTCACTGAATTGAAAGGG - Intergenic
1013975090 6:116067934-116067956 ATGCCAAGACTCAAGTCCAAGGG - Intergenic
1014304576 6:119724610-119724632 CTGTCATCACTGAAATACAAAGG - Intergenic
1014382920 6:120766333-120766355 ATGCCATCTCTGCATATCAATGG + Intergenic
1015508917 6:134018156-134018178 ATGCCAGCACTGACTTCAACAGG - Intronic
1018450201 6:163900781-163900803 ACGCCATTACGGAATTCAAAAGG - Intergenic
1023003181 7:35833335-35833357 ATTCAATTAATGAATTCCAAGGG - Intronic
1023656299 7:42424866-42424888 CTGCCATCACTGCAATCCAGTGG + Intergenic
1023771632 7:43561910-43561932 ATGTCCTCACTCAAGTCCAAAGG - Exonic
1026247419 7:68633654-68633676 ATGCTGTGCCTGAATTCCAAAGG + Intergenic
1028932504 7:96428737-96428759 CTGCCATCATTGAAACCCAAAGG + Intergenic
1029248854 7:99221920-99221942 ATGACCCCACAGAATTCCAAGGG + Intergenic
1034260135 7:149750121-149750143 ATGCCAGCTCTGTATTCCAAGGG - Intergenic
1034657427 7:152740749-152740771 ATGGCACCACTGCACTCCAAGGG - Intergenic
1036828190 8:11996194-11996216 CTGCCAGCACTGGATCCCAAAGG + Exonic
1036921377 8:12858590-12858612 ATGCCATCCCTCCCTTCCAATGG - Intergenic
1038900568 8:31838996-31839018 ATGCCAGCACTACATTTCAAGGG - Intronic
1039161008 8:34620005-34620027 ATGACATCACAGAAATACAAAGG - Intergenic
1039732504 8:40294891-40294913 ATTCCATGACTGGAGTCCAAAGG + Intergenic
1039809796 8:41036516-41036538 AGTTCATCACTGCATTCCAAAGG + Intergenic
1040726159 8:50384187-50384209 ATGCCATAACTGTTTTCAAAAGG + Intronic
1045521442 8:102906342-102906364 ATGCCACCTCTGCATTCCAATGG + Intronic
1045827648 8:106419049-106419071 ATGCCATCAATGAAAACCATAGG - Intronic
1047289865 8:123520355-123520377 ATGACACCACGGAATTCCAGAGG - Intronic
1048764652 8:137830942-137830964 ATGACTTAACTGCATTCCAAAGG + Intergenic
1050050388 9:1594764-1594786 ATGCCATGACTGTAATCAAATGG + Intergenic
1050297927 9:4225443-4225465 ATGCCATCACTGAATTCCAATGG - Intronic
1050853768 9:10323338-10323360 ATCACACCACTGCATTCCAATGG - Intronic
1052773007 9:32706603-32706625 AGTCAGTCACTGAATTCCAAAGG + Intergenic
1053608674 9:39687201-39687223 ATGCCTTCAGTGATGTCCAAGGG + Intergenic
1054244850 9:62655209-62655231 ATGCCTTCAGTGATGTCCAAGGG - Intergenic
1054558976 9:66689740-66689762 ATGCCTTCAGTGATGTCCAAGGG - Intergenic
1055927821 9:81528830-81528852 GTACCATCACTGAATTTCCAAGG - Intergenic
1056477292 9:86965068-86965090 ATGGCAGCTCTGAACTCCAAGGG - Intergenic
1057990006 9:99758632-99758654 ATGCCATCAGTGATATCCATAGG - Intergenic
1058149711 9:101450910-101450932 ATGGCAGGACTGAATTCCATGGG - Intergenic
1058438555 9:104986767-104986789 AAGCCTTCTTTGAATTCCAAAGG + Intergenic
1060781505 9:126416524-126416546 CTGGCATCACTGATTTCAAAAGG + Intronic
1062042620 9:134411137-134411159 AGGCCATCACCGACTTCCGAGGG - Intronic
1187348389 X:18488825-18488847 TAGCCATGCCTGAATTCCAAAGG - Intronic
1191646578 X:63488173-63488195 AGGGCAGCACTGAGTTCCAATGG - Intergenic
1191889411 X:65925402-65925424 ATGGCATCACTGTTTTCCCAAGG - Intergenic
1192330799 X:70173788-70173810 GGGCCATCAGAGAATTCCAAAGG - Intergenic
1192855069 X:75000219-75000241 ATGCTTTCACTGTATCCCAAAGG + Intergenic
1196264512 X:113626446-113626468 AGGACAGCACTGAGTTCCAAAGG + Intergenic
1198793057 X:140366643-140366665 CTGTCCTCACTGAATTGCAATGG - Intergenic
1199777522 X:151028427-151028449 CTACCCTCACTCAATTCCAATGG + Intergenic
1202299748 Y:23399777-23399799 ATGACATCCCTGGACTCCAAAGG - Intergenic
1202571061 Y:26270821-26270843 ATGACATCCCTGGACTCCAAAGG + Intergenic