ID: 1050297928

View in Genome Browser
Species Human (GRCh38)
Location 9:4225474-4225496
Sequence CTCATTCCTGCAACCTAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050297927_1050297928 8 Left 1050297927 9:4225443-4225465 CCATTGGAATTCAGTGATGGCAT 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1050297928 9:4225474-4225496 CTCATTCCTGCAACCTAACGAGG No data
1050297925_1050297928 11 Left 1050297925 9:4225440-4225462 CCTCCATTGGAATTCAGTGATGG 0: 1
1: 0
2: 1
3: 3
4: 118
Right 1050297928 9:4225474-4225496 CTCATTCCTGCAACCTAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050297928 Original CRISPR CTCATTCCTGCAACCTAACG AGG Intronic
No off target data available for this crispr