ID: 1050298174

View in Genome Browser
Species Human (GRCh38)
Location 9:4228053-4228075
Sequence ACTTATAAGAACAAAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050298162_1050298174 26 Left 1050298162 9:4228004-4228026 CCCCACTGTATCCATTTCTCATC 0: 1
1: 0
2: 1
3: 19
4: 309
Right 1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG No data
1050298167_1050298174 4 Left 1050298167 9:4228026-4228048 CCTCAAACCAGGAGAATTTCTCC 0: 1
1: 0
2: 5
3: 49
4: 355
Right 1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG No data
1050298163_1050298174 25 Left 1050298163 9:4228005-4228027 CCCACTGTATCCATTTCTCATCC 0: 1
1: 0
2: 1
3: 23
4: 227
Right 1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG No data
1050298168_1050298174 -3 Left 1050298168 9:4228033-4228055 CCAGGAGAATTTCTCCCCATACT 0: 1
1: 0
2: 1
3: 13
4: 288
Right 1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG No data
1050298165_1050298174 15 Left 1050298165 9:4228015-4228037 CCATTTCTCATCCTCAAACCAGG 0: 1
1: 0
2: 3
3: 21
4: 285
Right 1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG No data
1050298164_1050298174 24 Left 1050298164 9:4228006-4228028 CCACTGTATCCATTTCTCATCCT 0: 1
1: 0
2: 2
3: 37
4: 380
Right 1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050298174 Original CRISPR ACTTATAAGAACAAAAGGGA AGG Intronic
No off target data available for this crispr