ID: 1050300471

View in Genome Browser
Species Human (GRCh38)
Location 9:4253258-4253280
Sequence TTATCTACAAGCCCCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050300454_1050300471 27 Left 1050300454 9:4253208-4253230 CCCACAGCCGCCCCTTTCCCCAG No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300469_1050300471 -6 Left 1050300469 9:4253241-4253263 CCAGGGAGATGGGAGTTTTATCT No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300459_1050300471 16 Left 1050300459 9:4253219-4253241 CCCTTTCCCCAGGTGCTCTGTCC No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300463_1050300471 10 Left 1050300463 9:4253225-4253247 CCCCAGGTGCTCTGTCCCAGGGA No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300460_1050300471 15 Left 1050300460 9:4253220-4253242 CCTTTCCCCAGGTGCTCTGTCCC No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300457_1050300471 20 Left 1050300457 9:4253215-4253237 CCGCCCCTTTCCCCAGGTGCTCT No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300468_1050300471 -5 Left 1050300468 9:4253240-4253262 CCCAGGGAGATGGGAGTTTTATC No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300455_1050300471 26 Left 1050300455 9:4253209-4253231 CCACAGCCGCCCCTTTCCCCAGG No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300464_1050300471 9 Left 1050300464 9:4253226-4253248 CCCAGGTGCTCTGTCCCAGGGAG No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300465_1050300471 8 Left 1050300465 9:4253227-4253249 CCAGGTGCTCTGTCCCAGGGAGA No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data
1050300458_1050300471 17 Left 1050300458 9:4253218-4253240 CCCCTTTCCCCAGGTGCTCTGTC No data
Right 1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050300471 Original CRISPR TTATCTACAAGCCCCTGACT GGG Intronic