ID: 1050301102 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:4259715-4259737 |
| Sequence | CTCTATTCACAGATGGGGTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050301095_1050301102 | 10 | Left | 1050301095 | 9:4259682-4259704 | CCTAGCGAAGGAGGCAGGACCTG | 0: 1 1: 0 2: 3 3: 30 4: 281 |
||
| Right | 1050301102 | 9:4259715-4259737 | CTCTATTCACAGATGGGGTGGGG | No data | ||||
| 1050301096_1050301102 | -9 | Left | 1050301096 | 9:4259701-4259723 | CCTGTTCAAACTTGCTCTATTCA | 0: 1 1: 0 2: 0 3: 13 4: 128 |
||
| Right | 1050301102 | 9:4259715-4259737 | CTCTATTCACAGATGGGGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050301102 | Original CRISPR | CTCTATTCACAGATGGGGTG GGG | Intronic | ||
| No off target data available for this crispr | |||||