ID: 1050301102

View in Genome Browser
Species Human (GRCh38)
Location 9:4259715-4259737
Sequence CTCTATTCACAGATGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050301095_1050301102 10 Left 1050301095 9:4259682-4259704 CCTAGCGAAGGAGGCAGGACCTG 0: 1
1: 0
2: 3
3: 30
4: 281
Right 1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG No data
1050301096_1050301102 -9 Left 1050301096 9:4259701-4259723 CCTGTTCAAACTTGCTCTATTCA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050301102 Original CRISPR CTCTATTCACAGATGGGGTG GGG Intronic
No off target data available for this crispr